(100 POINTS + BRAINLIEST) i don't know which subject this belongs to but this is an earth science class!!!

Tell the story of the life cycle of a star the size of our sun, Be sure to include all stages from "pre-birth" to death.
Describe the differences between our sun's life cycle to a star who is at least 5 times bigger than our sun.

Answers

Answer 1

The life cycle of a star the size of our sun starts with a nebula, a huge cloud of dust and gas. The gravity of the nebula compresses the cloud until the atoms fuse together, creating a star. This stage is known as pre-birth.

Next, the star enters a main sequence phase, where it shines brightly for millions of years, powered by nuclear fusion.

Eventually the star will slowly run out of hydrogen and the fusion process will become less and less efficient. The star will expand and become what is known as a red giant. This marks the end of the main sequence phase.

After this point, the star expels its outer layers, leaving behind a small, hot core called a white dwarf. It will continue to cool down until it becomes a black dwarf.

If the star is at least 5 times bigger than our sun, it will enter a different life cycle. After the red giant phase, the star will undergo a supernova explosion, which will spew dust and gas into the surrounding areas. These remainders will later form new stars, planets, and other cosmic bodies. What's left of the star will become a neutron star or a black hole.


Related Questions

What do i do if i smell gas inside of the house?

Answers

Answer:

open the windows, turn off all electronics (take out all of the plugs), then find where the gas is coming from.

Explanation:

What volume (in L) of nitrogen will be produced from the reaction of 6. 8 L of carbon monoxide?


2CO(g)+2NO(g)>N2(g)+2CO2(g)

Answers

The volume of nitrogen produced from the reaction of 6.8 L of carbon monoxide is 3.7 L

In order to determine the volume of nitrogen produced from the reaction of 6.8 L of carbon monoxide, we need to use the balanced equation for the reaction:

2CO(g) + 2NO(g) -> N2(g) + 2CO2(g)

From the equation, we can see that for every 2 moles of CO that react, 1 mole of N2 is produced. The volume of a gas is directly proportional to the number of moles of the gas present.

If the initial volume of CO is 6.8 L, we can assume that the number of moles of CO is

6.8 L / 24.45 L/mol = 0.278 mol.

Therefore, the number of moles of N2 produced would be

0.278 mol CO * (1 mol N2 / 2 mol CO) = 0.139 mol N2.

Finally, using the ideal gas law PV = nRT (where P is pressure, V is volume, n is the number of moles, R is the ideal gas constant, and T is temperature), we can calculate the volume of N2 produced:

V = nRT / P

V = 0.139 mol N2 * (8.314 J/mol*K) * (273 K) / (1 atm) = 3.7 L

So, the volume of nitrogen produced from the reaction of 6.8 L of carbon monoxide is 3.7 L.

Learn more about Ideal Gas Law here: https://brainly.com/question/4147359

#SPJ4

A compound is composed of carbon and hydrogen and has an empirical
formula of CH. The molar mass of the compound is experimentally
determined to be 78.12 g/mol. What is the molecular formula for the
compound?

Answers

The empirical formula for the given compound is C6H6.

What is empirical formula?

The molecular formula represents the precise digits of the atoms found in the given molecule of the compound, whereas the empirical formula represents the proportional of the atoms found in the provided compound.

How empirical formula calculated?

The empirical formula defines the individual atoms that make up a species in the simplest whole number ratio possible. The

The empirical formula is always multiplied by the molecular formula.

Given the foregoing, the empirical formula for the molecular formula is n.

Because of this, the molecular formula is: 78.0 g m o l 1 = n ( 12.011 + 1.00794 ) g m o l 1

n \s= \s78 \s12.011 \s+ \s1.00794 =6 \s .

And the chemical formula is C 6 H 6.

Molecular formula, although not always.≡

empirical formula, which includes the multiple n=1 \s .

Learn more about  empirical formula here: https://brainly.com/question/12973146

#SPJ1

Which action characterized Earth's earliest atmosphere (atmosphere I) ?



Helium and hydrogen gases escaped earth's gravity.




Increased oxygen allowed reptiles to thrive.




Heat energy was retained and water vapor condensed.




Ultraviolet light split water vapor into hydrogen and oxygen

Answers

The action "Heat energy was retained and water vapor condensed." characterized Earth's earliest atmosphere (atmosphere I)

Earth's earliest atmosphere, also known as atmosphere I, was primarily composed of methane, ammonia, and water vapor. The heat energy from the young Earth's molten surface caused these gases to rise and cool, leading to the condensation of water vapor and the formation of oceans. This process is known as the "greenhouse effect," as the retained heat energy allowed for the formation of a hospitable environment for the emergence of life. Ultraviolet light from the sun also played a role in the formation of the atmosphere by breaking down water vapor into hydrogen and oxygen, but this was not the primary process that characterized atmosphere I.

Learn more about Atmosphere here: brainly.com/question/26767532

#SPJ4

Chlorine dioxide, ClO2, si a reddish-yellow gas that is soluble in water. In basic solution it gives ClO3- and ClO2- ions. 2ClO2(aq) + 2OH-(aq) ?

ClO3-(aq) + ClO2- (aq) + H2O. To obtain the rate law for this reaction, the following experiments were run and, for each, the initial rate of the reaction of ClO2 as determined. Obtain the rate law and the value of the rate constant

Answers

Chlorine dioxide is a powerful oxidizing agent and disinfectant used to sanitize and disinfect water, air, surfaces, and medical equipment.

What is Chlorine?

Chlorine is a chemical element found in the halogen group on the periodic table. It has the atomic symbol Cl, and its atomic number is 17. Chlorine is a pale green gas at room temperature, and it is highly reactive. Chlorine is widely used in water treatment and in the production of cleaning products, plastics, and pesticides.

The rate law for this reaction is rate = k[ClO2][OH-], where k is the rate constant. To calculate the rate constant, we can use the following equation:

k = (rate2 - rate1)/([ClO2]2 - [ClO2]1)([OH-]2 - [OH-]1)

Substituting the values for experiments 1 and 2, we get:

k = (0.00276 - 0.0248)/((0.020 - 0.060)(0.030 - 0.030)) = -0.142

The value of the rate constant is k = -0.142 mol/((L s)mol2).

To calculate the initial rate of reaction in experiment 4, we can use the following equation:

rate = k[ClO2][OH-]

Substituting the values for experiment 4, we get:

rate = -0.142(0.040)(0.060) = -0.0043 (mol/((L s))

To know more about Chlorine,

https://brainly.com/question/24218286

#SPJ4

Write word equation as a chemical equation:

When chlorine gas is added to an aqueous solution of potassium iodide, the reaction yields solid iodine and an aqueous solution of potassium chloride

Answers

Answer:

Here's the chemical equation:

Cl2 + KI → KCl + I2

Cl2(g)+2KI(aq)→I2(s)+2KCl(aq)

What is the concentration of the hydroxide ion? Given that the concentration of the hydronium ion is 2.3 X 10^-7 M

Answers

Answer:

4.35 * 10^-8 M

Explanation:

Since the concentration of the hydronium ion= 2.3 X 10^-7 M

And we know that;

[H3O^+] [OH^-] = 1 * 10^-14

[H3O^+]  = concentration of the hydronium ion

[OH^-] = concentration of the hydroxide ion

So;

[OH^-] =1 * 10^-14/[ H3O^+]

But [H3O^+] = 2.3 X 10^-7 M

[OH^-] = 1 * 10^-14/2.3 X 10^-7

[OH^-] = 4.35 * 10^-8 M

different between ionic and metallic bond ​

Answers

Answer:

Whereas ionic bonds join metals to non-metals, metallic bonding joins a bulk of metal atoms.

Explanation:

hope this helps

For which d orbital(s) do the lobes point directly at the ligands in a square-planar crystal field? Check all that apply.
O dzy
O dz2
O dzz
O dzy y^2
O dyz
submit

Answers

The dz2 and the dx2-y2 orbitals have lobes that point directly at the ligands in a square-planar crystal field in d orbitals.

The d orbitals are a set of atomic orbitals found in the second energy level (n = 2) of an atom. They have a higher energy than the s and p orbitals in the first energy level (n = 1), and are represented by the letters d, dx, dy, dz and dxy, dxz and dyz.The d orbitals are composed of four orbitals which are degenerate (having the same energy) in an isolated atom. But when an atom is in a compound, the d-orbitals split into different energy levels due to the influence of the electrostatic forces of the neighboring atoms. This is called the crystal field splitting, which depends on the symmetry of the crystal and the coordination number of the central atom.

Learn more about atomic orbitals here:

https://brainly.com/question/29561958

#SPJ4

Which of the following is a physical property of minerals?

Answers

Answer:

Below

Explanation:

You didn't list any choices but stuff life color, density, texture,hardness, luster are PHYSICAL properties

This is the wrong answer ignore this

What do these two changes have in common?

a slice of banana turning brown
acid rain weathering a marble statue
Select all that apply.

Both are only physical changes
Both are only chemical changes
Both are caused by heating
Both are caused by cooling

Answers

Answer:

both are only physical changes

Answer:both are only chemical

Explanation:

What is the mass of a sample of NH3 containing 6.3 x 1024 molecules of NH3?
O 157 grams
O 178 grams
O 182 grams
198 grams

Answers

Answer:

178 grams

Explanation:

Took Test

The mass of a sample of NH3 containing 6.3× 10²⁴ molecules of NH₃ is 178 gm , i.e. Option B

What is a mole ?

A mole is defined as 6.022 × 10²³ atoms, molecules, ions, or other chemical units.

and the molar mass of a substance is defined as the mass of 1 mole of that substance, expressed in grams per mole.

It is equal to the mass of 6.022 × 10²³ atoms, molecules, or formula units of that substance.

6.022× 10²³ molecules are present in 1 mole

6.3× 10²⁴ molecules will be present in

[tex]\rm =\dfrac{6.3\times 10^{24}}{6.022\times 10^{23} } \;moles[/tex]

=  10.46 moles

Molar mass(1 mole) of NH₃ is 17 gm

10.46 moles will have mass of 10.46* 17 = 178 gm

The mass of a sample of NH₃ containing 6.3× 10²⁴ molecules of NH₃ is 178 gm , i.e. Option B.

To know more about mole

https://brainly.com/question/26416088

#SPJ2

PLEASE HELP! 50 PTS! WILL GIVE BRAINIEST!!!

Answers

Answer:

Explanation:

C ADBBECDEA

Answer:

1 - C

2 - A

3 - D

4 - B

5 - B

6 - E

7 - C

8 - D

9 - E

10 - A

Explanation:

according to the department of transportation hazardous materials are defined as

Answers

Hazardous materials are substances or chemicals that pose a health hazard, a physical hazard, or harm to the environment.

What is hazardous materials?Weapons of mass destruction, as well as other matter or energy that have the potential to do harm to people, the environment, and property, when discharged.The EPA divides hazardous waste into three categories: listed, characteristic, and mixed radiological waste. Although there are numerous subclasses within each of these groups, the following are the broad groupings.Any cause of potential danger, harm, or negative health impacts on something or someone is a hazard. Basically, a risk is the potential for harm or a negative outcome (for example, to people as health effects, to organisations as property or equipment losses, or to the environment).A hazard is a potential source or circumstance that could cause harm to people or their health, damage to property, or harm to the environment.

To learn more about hazardous materials refers to:

brainly.com/question/27318175

#SPJ1

8. What is the kinetic energy of a 0.02 kg bullet that is traveling 300 m/s? Express your answer in joules.​

Answers

900J

Explanation:
Well, kinetic energy is expressed through the equation:
KE
=
1
2
m
v
2

m
is the mass of the object in kilograms

v
is the velocity of the object in meters per second

So, we plug in the values, which are
m
=
0.02

kg

v
=
300

m/s

And we get,
KE
=
1
2

0.02

kg

(
300

m/s
)
2

=
1
2

0.02

kg

90000

m
2
/s
2

=
900

kg m
2
/s
2

=
900J

What is the relationship between the enthalpy (AH) and entropy (AS) of a
reaction that is never spontaneous?
OA. +AH,-AS
OB. -AH, +AS
OC. -AH-AS
OD. +AH, +AS
SUBMIT

Answers

The relationship between the enthalpy (ΔH) and entropy (ΔS) of a reaction that is never spontaneous is -ΔH, +ΔS option - B is correct answer.

A spontaneous reaction is what?

When a reaction occurs spontaneously, the system doesn't require any additional energy input because the change in free energy is negative.

When the enthalpy change is negative and the entropy change is positive, the reaction is always spontaneous.

The free energy change is always positive and the reaction is never spontaneous if the reaction is endothermic (H positive) and the entropy change S is negative (less disorder).

Although a spontaneous reaction may result in an increase or decrease in entropy or enthalpy, it will always result in a decrease in free energy, which is a negative G.

To know more about enthalpy visit:

https://brainly.com/question/13996238

#SPJ1

A beautyberry is a type of shrub that grows well in the southern United States. Some students have a small beautyberry shrub that is growing near their school. They record the number of berries, ripe or unripe, and the number of flowers at different times throughout the year.
Table. Column headings. Month, ripe berries, unripe berries, flowers. September, 9, 4, 2. October, 5, 10, 4. November, 5, 7, 3. December, 2, 3, 1. February, 3, 2, 0. March, 6, 11, 5. April, 12, 5, flowers 9. June, 3, 8, 2.

Which statement best explains what is shown in their data?

Choose the correct answer.

Responses
A.The beautyberry relies on wind to spread its seeds.
B..The beautyberry relies on one type of animal to eat the berries.
C.The beautyberry uses asexual reproduction to make new plants.
D.The beautyberry increases its chances of reproduction because its berries do not all become ripe at the same time.

Answers

The statement that best explains what is shown in their data is option D. The beautyberry increases its chances of reproduction because its berries do not all become ripe at the same time.

What is the beautyberry  about?

The data shows that the number of ripe berries and unripe berries varies from month to month, with the most ripe berries in April and the least in December.

This indicates that the beautyberry does not have all of its berries ripen at the same time, which increases the chances of some of them being eaten and spread by animals. This would help increase the chances of the beautyberry reproducing and spreading to new locations.

Therefore, It does not seem from the data provided that it relies on wind to spread its seeds or that it relies on one type of animal to eat the berries, or it uses asexual reproduction to make new plants.

Learn more about beautyberry from

https://brainly.com/question/26027910

#SPJ1

Write the expression for the solubility product constant for:Ca3(PO4)2 (s) 3Ca2+ (aq) + 2PO43- (aq)

Answers

The solubility product constant (Ksp) for a substance is the equilibrium constant for the reaction between the dissolved ions of the substance and its solid form. In the case of Ca3(PO4)2, the equation for the reaction in water is: Ca3(PO4)2 (s) ↔ 3Ca2+ (aq) + 2PO43- (aq)

The solubility product constant, Ksp, for this reaction is represented by the equation:

Ksp = [Ca2+]^3 * [PO43-]^2Where [Ca2+] represents the concentration of calcium ions in molarity and [PO43-] represents the concentration of phosphate ions in molarity.

Solubility refers to the maximum amount of a substance that can dissolve in a given solvent at a given temperature and pressure. For example, the solubility of sugar in water is the maximum amount of sugar that can dissolve in water at a given temperature and pressure. The solubility of a substance can be influenced by temperature, pressure, and the presence of other dissolved substances.

Learn more about solubility product here:

https://brainly.com/question/857770

#SPJ4

Which statement best describes an electron going from shell 1 to shell 3 as shown in the picture below?
1. The electron is changing into a neutron
2. The electron is moving from one atom to another atom
3. The electron is moving from an excited state to its ground state
4. The electron is moving from its ground state to an excited state

Answers

Answer:

the electron is moving from one atom to another

How does oxygen affect orcas?

Answers

The orcas will compensate the lack of the oxygen that being respired for the minute at time and with the high amount of the hemoglobin in the blood.

The orcas will be able to slow down their heart beat when they are diving . this will decrease the amount of the oxygen demand but this not good for them it will be very stressful on their body.

The hemoglobin will increase the efficiency of their respiration.  The orcas are the sea mammals . the orcas will be dive for the long period of the time in to the water. They will easily breathe through blowhole.

To learn more about orcas here

https://brainly.com/question/29632391

#SPJ4

A car has a mass of 2,050 kg and is traveling at 28 meters per second. What is the car's kinetic energy?

Answers

After solving the equation the car's kinetic energy is 783,500 kg m2/s2.

What is kinetic energy?

Kinetic energy is the energy of motion, or the energy associated with an object or system due to its motion. It is a form of energy that can be converted into other forms of energy, such as thermal energy, sound energy, electrical energy, and so on.

The car's kinetic energy is the energy it has due to its motion. Kinetic energy is calculated as KE = 1/2mv2, where m is mass and v is velocity. In this case, the car has a mass of 2,050 kg and is traveling at 28 meters per second. Plugging these values into the equation gives:
KE = 1/2(2050 kg)(28 m/s)2
= 1/2(2050 kg)(784 m2/s2)
= 783500 kg m2/s2
Therefore, the car's kinetic energy is 783,500 kg m2/s2.

To learn more about kinetic energy
https://brainly.com/question/26520543
#SPJ1

You just created the equality 1 fluid oz = 29. 7 mL. Use this equality to determine how many ounces of water will be measured using the measuring cup introduced before Part A when making the cake.

Express your answer numerically in ounces to two significant figures

Answers

2 ounces of water will be measured using the measuring cup introducing before part A when making the cake.

Both units (that is, ml and ounces) are equal, meaning they measure the same quantity and can be converted to each other.

Given that:

1fluid oz = 29.7ml

Part A measurements are not shown. Therefore, we will explain using hypothetical values.

Let the amount of water measured with the measuring cup in part A be 10 ml.

The equivalent number of ounces (x) is calculated as follows:

1 fluid oz = 29.7ml

x = 10ml

By using equality

x * 29.7ml = 1 fluid oz * 10ml

By canceling common units

x * 29.7 = 10 fluid oz

Divide both sides by 29.7.

x = 0.3367 fluid oz

Approximate to the nearest half.

x = 0.5 fluid oz

This means that the equivalent amount of water is 0.5 ounces.

What if the measurement is 55mL.

We apply the same steps here also:

x fluid oz = 55ml

x *29.7 = 1 fluid oz * 55 ml

Divide both sides by 29.7

x = 2 fluid oz

This means that the equivalent amount of water is 2 ounces.

Learn more about equivalent visit:

brainly.com/question/1434279

#SPJ4

. Which one is formed by the combination of many tissues?​

Answers

Answer:

organs is the right answer

Explanation:

An organ is a structure that is composed of at least two or more tissue types and performs a specific set of functions for the body. Many organs working together to accomplish a common purpose is called an organ system.

Hope that helps you bud..!

Take care..

Buhbye!

How many grams of iron (III) oxide are needed?

Answers

Answer:

The SI base unit for amount of substance is the mole. 1 mole is equal to 1 moles Iron(III) Oxide, or 159.6882 grams.

the safety air bag in automobiles are inflated by nitrogen gas by the rapid decomposition of sodium azide:

Answers

sodium azide (NaN3) is used to inflate the safety airbags in automobiles (g) This airbag should be filled with N2 at a pressure of 1.15 atm and temperature of 26.0°C. It has a volume of 36 L.

Modern automobiles use numerous technical components and subsystems, each of which performs a specific design function. Some of these have thousands of individual pieces and were made possible by new or improved technologies, such as electronic computers, high-strength polymers, and novel alloys of steel and nonferrous metals. Air pollution, safety regulations, and global manufacturer competition, among other things, have all contributed to the development of some subsystems.

With an estimated 1.4 billion in use worldwide, passenger vehicles have become the main form of family transportation. In the United States, where more than three trillion miles (almost five trillion kilometers) are traveled annually, roughly one-fourth of these are located.

Learn more about automobiles here:

https://brainly.com/question/16579482

#SPJ4

why the bond between hydrogen and oxygen in a water molecule is more polar than the bond between hydrogen and nitrogen in an ammonia molecule.

Answers

Since oxygen has a higher electronegative charge than hydrogen, the two bonds that are created will be polar covalent, which means that oxygen.

which has a higher electronegative charge, will have a partial negative charge, and hydrogen, which has a partial positive charge. Each water molecule has a small hydrogen charge that attracts neighboring oxygen atoms and negatively charged areas of other molecules. While holding water together and giving it intriguing features, the hydrogen bond between the hydrogen of one water molecule and the oxygen of another... For water, this is how it functions. Due to the molecule's bent structure, water (H 2 O) is polar. Most of the negative charge from the oxygen is indicated by the shape.

To learn more about electronegative please click on below link

https://brainly.com/question/17762711

#SPJ4

Can someone please help I’ll give brainliest!!!

Answers

Single replacement because only one letter is being switched out in the reaction

Please help : ) and please explain in answer

Answers

The transfer of energy doe not always affect the appearance of the lake because it can attain a form that is quite similar to the other. It can be because of conduction, convection, and radiation.

What are the processes of heat transference?

Heat transference can be described as a natural phenomenon that can be caused by conduction, convection, or radiation.

Convection can be defined as the transfer of energy in a given fluid such as, in this case, water. The energy transfer is due to particular molecular motion, energy is transferred by bulk, or macroscopic, the motion of the fluid.

Radiation can be defined as heat transfer through space due to electromagnetic radiation. Conduction can be defined as the transfer of energy between molecules due to direct contact.

Learn more about heat transfer, here:

brainly.com/question/16084179

#SPJ1

A beautyberry is a type of shrub that grows well in the southern United States. Some students have a small beautyberry shrub that is growing near their school. They record the number of berries, ripe or unripe, and the number of flowers at different times throughout the year.

Table. Column headings. Month, ripe berries, unripe berries, flowers. September, 9, 4, 2. October, 5, 10, 4. November, 5, 7, 3. December, 2, 3, 1. February, 3, 2, 0. March, 6, 11, 5. April, 12, 5, flowers 9. June, 3, 8, 2.

Which statement best explains what is shown in their data?

Choose the correct answer.

Responses
A.The beautyberry relies on wind to spread its seeds.
B..The beautyberry relies on one type of animal to eat the berries.
C.The beautyberry uses asexual reproduction to make new plants.
D.The beautyberry increases its chances of reproduction because its berries do not all become ripe at the same time.

Answers

Note that statement best explains what is shown in the above-tabularized data is: "The beautyberry increases its chances of reproduction because its berries do not all become ripe at the same time. (Option D)

What is the rationale for the above answer?

The statistics in the above table appear to reflect the ripening of berries and the number of blossoms of a plant, presumably called beautyberry. It can be noticed that the amount of ripe berries and blossoms varies each month.

This implies that the beautyberry does not produce all of its berries at once, but rather over the course of several months. This might boost the odds of reproduction by providing a food supply for animals and birds for a longer length of time.

Learn more about reproduction:
https://brainly.com/question/7464705
#SPJ1

Do you multiply grams to moles?

Answers

How do you convert grams to moles??imma answer it for you, Well first you have a rule,MOLE =MASS /MOLAR MASS so you basically look at the periodic table and get the molar mass out and distribute you’ll get the answer
Other Questions
Explain why a solid has a definite shapeand volume.6. How does the arrangement of atoms in mostsolids differ from the arrangement of atoms ina liquid? A person is standing 18 feet from the base of a tree and there's a bird's nest in the tree 10 feet above the ground. what is the angle of elevation from the person to the birds nest? round to the nearest tenth of a degree? i need help im almost done and this is my second to last question probably helpppp please help !!!!!!!! conjugate these three words in the future tense: I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing.