4) Find the perimeter of square whose side is 6.4cm​

Answers

Answer 1

Answer:

Perimeter = 25.6 cm

Explanation:

Square Perimeter Formula: [tex]P = 4 * s (side length)[/tex]

[tex]P = 4*6.4cm \\P = 25.6 cm[/tex]


Related Questions

The question is below, please help

Answers

im gonna go ahead and say it is 25



pls let me be right

Please help.
Is algebra.
PLEASE HELP NO LINKS OR FILES.
I don't want links.

Answers

Answer:

A

cuz polynomials cannot have negative exponents

Step-by-step explanation:

Which expression means the same as "25 less than 5y"?
A. 5y - 25
B. 25 - 5y
C. 5y - 25
D. 25 = 5y

Answers

Answer:

a) 5y - 25

Step-by-step explanation:

Amelia is using substitution to determine if 8 is a solution to the equation. Complete the statements. 6a = 42 for a = 8 First, Amelia must substitute 8 for the using To simplify, Amelia must 8 a solution of the equation. pls hurry I'm on timer​

Answers

8 for a using mulipulcation must divide

Answer:

the answers are

First, Amelia must substitute 8 for the

✔ variable

using

✔ parentheses

.

To simplify, Amelia must

✔ multiply 6 by 8

.

8

✔ is not

a solution of the equation.

Step-by-step explanation:

6
There are 20 sweets in a bag.
Seven of them are strawberry.
A sweet is taken at random from the bag.
What is the probability that the sweet taken is not strawberry?

Answers

7 of the sweets in the bag are strawberry. Since there are 20 sweets total in the bag, 20 - 7 = 13 sweets in the bag must be non-strawberry.

The probability that a sweet taken at random from the bag is not strawberry would thus be 13/20.

Find the surface area of the rectangular prism.
2 cm
5 cm
10 cm

Answers

Answer:

2(2x5) + 4(5x10)

2(10) + 4(50)

20 + 200

220 cm. is your answer

Answer:

Step-by-step explanation:

2×5×10= 900

The line plot below shows the heights of players on a basketball team.

A line plot named

Which of the following statements are true? Select all that apply.

A.
There are 9 players on the team.

B.
76 inches is an outlier.

C.
More than half of the players are 79 inches or taller.

D.
3 more players are 84 inches tall than are 81 inches tall.

E.
The difference between the tallest and shortest player is 15 inches.

Answers

I think the answer is E

The difference between the tallest and shortest player is 15 inches.

More than half of the players are 79 inches or taller.

The correct option is (C) and (E).

What is graph plotting?

A plot is a graphical technique for representing a data set, usually as a graph showing the relationship between two or more variables.

As we see the plot.

The tallest =84 inch and the shortest =69 inch

So, The difference between the tallest and shortest player is 15 inches.

7 players are in range of 68- 78

8 players are in range of 79-84

Thus,  More than half of the players are 79 inches or taller.

Learn more graph plotting here:

https://brainly.com/question/11616742

#SPJ2

there is a line that includes the point (2,2) and has a slope of 3. What is its equation in slope intercept form?

Answers

Answer:

y = 3x - 4

Step-by-step explanation:

y = 3x + b

2 = 3(2) + b

2 = 6 + b

-4 = b

y = 3x - 4

Find the area of the parallelogram.
22 cm
17 cm
25 cm
cm?
(Simplify your answer.)

Answers

Answer:

b=base of parallelogram

h=height of parallelogram

area of parallelogram=b×h

=25×17

=425cm square

Can somebody plz help me with surveys in math?

Answers

What are the surveys??

carpenter has a board that is 8 feet long. e cuts off two pieces. One piece is 32 feet ug and the other is 2 feet long. How ch of the board is left?​

Answers

Answer:

2 1/6 feet

Step-by-step explanation:

A carpenter has a board that is 8 feet long. He cuts off two pieces. One piece is 3 1/2 feet long and the other is 2 1/3 feet long. How much of the board is left?

Total length of the board = 8 feet

Piece A = 3 1/2 feet

Piece B = 2 1/3 feet

Piece A + piece B

= 3 1/2 feet + 2 1/3 feet

= 7/2 + 7/3

= (21+14) / 6

= 35/6

= 5 5/6 feet

Length of the board remaining = Total length of the board - length of the two pieces

= 8 feet - 35/6 feet

= (48-35) / 6

= 13/6 feet

= 2 1/6 feet

Length of the board remaining = 2 1/6 feet

If (t+10)+t=t+20, what is the value of t?​

Answers

Answer:

t = 10

Step-by-step explanation:

(10+10)+10 = 10+20

30 = 30

t = 10

Answer:l 3t + 30

Step-by-step explanation: eliminate redundant parathrse

What are the answers for the boxes

Answers

Answer:

= 2x + 3

Step-by-step explanation:

have a nice day!! :)

Dr. Rodriguez earns an annual salary of $204,000. If social security tax is 6% of your income, then how much will Dr. Rodriguez pay each year in social security tax?​

Answers

Answer: $12,240

Step-by-step explanation:

(204000)(.06)(1)=12240

if line M is parallel to line and, in the slope of M is -5/7, what is the slope of line end? Your denominator must be positive

(easy question, easy points)​

Answers

Answer:

7/5

Step-by-step explanation:

Everything is positive as I explained,

the answer of the reverse reciprocal is 7/5 because 7/5 is parallel to -5/7 so they are perpendicular to each other.

PLEASE HELP
Video Game Weather


In a video game, the chance of rain each day is always 30%. At the beginning of each day in the
video game, the computer generates a random integer between 1 and 50. Explain how you could
use this number to simulate the weather in the video game.
I

Answers

Answer:

35

Step-by-step explanation:

chad randomly chooses a card from a standard deck 30 times. what is the probability he gets a diamond exactly 4 times

Answers

Answer:

From a standard deck of cards, one card is drawn. What is the probability that the card is black and a jack? P(Black and Jack) P(Black) = 26/52 or ½ , P(Jack) is 4/52 or 1/13 so P(Black and Jack) = ½ * 1/13 = 1/26 A standard deck of cards is shuffled and one card is drawn. Find the probability that the card is a queen or an ace.

Step-by-step explanation:

A sofa regularly sells for $840. The sales price is$714. Find the percent decrease of the sale price from the regular price

Answers

Answer:

15%

Step-by-step explanation:

A 1.5m tall boy casts a 3m shadow. Calculate the height of a tree that simultaneously casts an 8m shadow.

Answers

If 1.5m boy makes a 3m that means it doubled. A 8m tree can probably be 16m

Which shows the measures in ascending order for the data below?

14, 18, 11, 11, 15, 18, 11, 12, 15

range, mode, mean, median
range, mean, median, mode
range, median, mode, mean
range, mode, median, mean

Answers

Step-by-step explanation:

range, mode, median, mean

Answer:

range, mode, mean, median

Step-by-step explanation:

I just did it on odyssey

Jacob wants to purchase a new computer, but he does not have enough money in his bank account to pay for one.

Which of these is not an option for Jacob?


He can purchase the computer now using his his debit card.

He can put more money in his bank account and use his debit card to purchase the computer at a later date.

He can buy the computer using cash once he has saved enough money.

He can purchase the computer now using his his credit card.

Answers

Answer:

A is wrong. A debit card uses the money you have.

look at pic below please show work.: )

Answers

Answer:

there no

Step-by-step explanation:

put the pic

hiii please help i’ll give brainliest:)

Answers

Im guessing A. But I would be wrong.

Answer:

I would choose A

Step-by-step explanation:

HELP HEP HELP LAST ONE OMG

Answers

can you take another photo the top part is a bit cut off

15/16 as a decimal rounded to the nearest tenth

Answers

Answer:

0.9

Step-by-step explanation:

[tex]\frac{15}{16}=0.9375\approx0.9[/tex]

We need to solve for x and y, help please
3x + 6y = 18

Answers

Answer:

the answer is 2

Step-by-step explanation:

3(2)+6(2)=

6+12=18

The answer is 2, it’s 2 because 3x + 6y is just 6+12 which equals 18.

Suppose quadrilateral ABCD is a square and the slope of BC is -n. What is the slope of AB?

Answers

Answer:

-p?

Step-by-step explanation:

In ΔPQR, the measure of ∠R=90°, the measure of ∠P=26°, and PQ = 8.5 feet. Find the length of QR to the nearest tenth of a foot.

Answers

Answer:

3.7feet

Step-by-step explanations

Using the sin rule

A/sin a = B/sin b

Let A = PQ = 8.5feet

B = QR = x feet

a = R = 90°

b = P = 26°

Substitute the values into the Sin rule

8.5/sin90 = x/sin26

8.5×sin 26 = x × sin 90

8.5×0.4383 = x× 1

3.7255 = x

Hence the length of QR to the nearest tenth 3.7feet

Here it is please make sure it’s right

Answers

Answer:

C. Car B travels 11 miles more

What is the value of W?

Answers

Answer:

w=5

Step-by-step explanation:

firstly angle SUT and angle SUV are congruent, hence:

w+10=3w

10=3w-w

10=2w

10/2=w

5=w

Other Questions
The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio escride otra vez este texto pero con los verbos en pretrito perfectoMe levanto (1) a las ocho, preparo (2) un caf y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)cuarenta minutos en llegar a la universidad; en el autobs leo (6); el autobs va (7) lleno de gente y es (8)muy incmodo.Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy(11) cansada. Despus, como (12) con mi amiga Helena y ms tarde tomamos (13) un caf en la cafeterialde la facultad. Vamos (14)........ a la biblioteca y estudiamos (15)..un rato.Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.Hablo (19) por telfono con mi novio y me acuesto (21) a las 24.00. Question poIn an auditorium, a charity show is conducted in order to raise at least $3,000. The auditorium canaccommodate up to 180 spectators. Tickets cost $12 for students and $20 for adults. Identify the system ofinequalities and the corresponding graph that determine whether the charity will reach its goal. Is each ion stable? Explain. Pleaaaaaaseeee10 pointsIn the playing card deck below what is the chance of pulling 4 face cards without replacing the cards in between pulls? Answer in decimal form rounded to the 6th digit after thedecimal anybody help? reporting fake answers tysm!! The match was __________ live all over the world why weren't Spanish explorations successful in North America many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high proportion of adenines and thymines? someone help me please S + 6 HNO3 --> H2SO4 + 6 NO2 + 2 H2OIn the above equation how many moles of water can be made when 28 moles of HNO3 are consumed?AND 2 NH3 + 3 CuO g 3 Cu + N2 + 3 H2OIn the above equation how many moles of water can be made when 76 moles of NH3 are consumed?