(a) The possible genotypes and phenotypes for the offspring 25% Yellow YY , 50% Green Yy , 25% yy .
(b) Percentage of the offspring would be yellow is50%.
(c) Percentage of be blue is 0%.
(d) Percentage of "goobers" (green) is 50%.
The young creation of living organisms, known in biology as progeny, can be created by a single organism or, in the event of sexual reproduction, by two organisms. A group of offspring is sometimes referred to as a brood or progeny in a more generic sense.
Your biological parents are the ones who gave birth to you. Basically, this is another term for kids. Offspring includes young humans, horses, gorillas, lizards, and gorillas. When a mother gives birth to quadruplets, she subsequently has a large family.
The genotypes of a specific cross or breeding experiment are predicted using the Punnett square, a square diagram. It bears Reginald C. Punnett's name, who developed the method in 1905. Biologists use the picture to estimate the likelihood.
To learn more about Punnett square :
https://brainly.com/question/3522181
#SPJ4
8. The table below shows the number of generations required to produce white
butterflies through natural selection Calculate the mean, or average, number
of generations it takes to produce white butterflies.
Answer:
mean is 44.8
median is 36
Range is 32
Explanation:
hope it helps
stay safe love u
btw can i get brainliest
Which of the following is true of biogeochemical cycles?
Explanation:
The carbon, oxygen, and nitrogen cycles are all biogeochemical cycles. They show the movement of elements through living and nonliving components of the Earth. Carbon, oxygen, and nitrogen, are essential components of life that pass through organisms and nonliving components, but are never used up.
What is the great red spot on Jupiter
A. Hurricane
B. Thunderstorm
C. Bad Weather
D.Tornado
What would happen to the population of snakes and rabbits if hawks were removed from the ecosystem?
On irreversible effect of both deforestation and water pollution on the environment is the -
A- extinction of species.
B- thinning of the ozone shield.
C- depletion of the atmospheric carbon dioxide levels.
what is the ratio of 15 minutes to 2 hours
Answer:
15mins : 2 hrs
15 mins : 120 mins
1 : 8
Answer:
1:8
Explanation:
Convert 2 hours to minutes:
60*2 = 120 minutes
15/120 = 1:8
Why isn't glycolysis considered a closed pathway?
Which two statements describe force?
Answer:
b........................
Antigen presenting cells in the human immune system work with T cells to kill invading pathogens (bacteria and viruses). Antigen presenting cells will identify the pathogen and present the antigen, which is a unique protein "name tag" of the pathogen, to the T Cell so that the T cell can find and kill the pathogen. This type of communication between the antigen presenting cell and the T cell is known as.
a. Direct contact b. Local signaling c. Long distance signaling d. Transduction signaling
This type of communication between the antigen presenting cell and the T cell is known as Transduction signaling, hence the correct option is d.
The act of a cell showing an antigen bound by major histocompatibility complex (MHC) proteins on its surface is known as antigen presentation, sometimes known as antigen presentation. Antigen presenting cell process antigens before they are presented to T cells. Antigens can be expressed in some form by almost all cell types. While cells that are infected with viruses (or cancer cells) can offer cytotoxic T cells with antigens that originate inside the cell, professional antigen-presenting cells, such as macrophages, B cells, and dendritic cells, provide helper T cells with exterior antigens. They may be found in several types of tissues. Through their T cell receptors, T cells may be able to recognise these complexes (TCRs).
To learn more about Antigen presenting cell click on the given link: https://brainly.com/question/13588471
#SPJ4
PBS Evolution: Great Transformations
1. If the world’s history were compressed into one hour, how long have humans been here?
Microbes. Single-celled organisms
2. How long ago did mammals first appear on earth?
Mammals first appeared about 200 million years ago
3. What type of animal did the skull that Dr. Gingrich discovered resemble?
Dr. Gingrich discovered resembled a whale
4. What did "Whale Valley" used to be?
Whale valley is a
5. What unusual feature did they find at the end of the early tetrapods’ limbs?
6. How long ago did animals first appear on Earth?
7. When the mouse "eyeless" gene was implanted into the fruit flies, what happened?
8. How would walking on two legs be an advantage?
9. What modifications does the human skeleton have?
Humans has the same transformation as other animals even though humans are special.
10. Summary/reflection:
Given that whales and other mammals resembled other mammals in terms of their skulls and other sculptures, based on the fossil evidence, humans have undergone evolutionary transitions.
The transition from land animals to whales is one of the most well-known instances of a supposed change cited by the evolution contingency in the opening of the program. The fossils of Pakicetus, Ambulocetus, Rhodocetus, Dorontid, and Basilosaurus show that this transition can be explained. Pakicetus only has a small portion of its cranium to display, as opposed to a whole transitional fossil.
The program portrays Ambulocetus as a fully preserved fossil of an aquatic mammal with legs, yet this is a stretch of the fact because the animal's skeleton was actually discovered to be extremely fragmented. Rhodocetus is solely represented in the series by a skull.
To know more about evolution, refer to the following link:
https://brainly.com/question/27748371
#SPJ4
The human genome project was able to map the human genome and it is now
completed. Why is this important in science?
Answer:
What is the Human Genome Project? The Human Genome Project was the international research effort to determine the DNA sequence of the entire human genome. In 2003, an accurate and complete human genome sequence was finished two years ahead of schedule and at a cost less than the original estimated budget.
Explanation:
The finished sequence produced by the Human Genome Project covers about 99 percent of the human genome's gene-containing regions, and it has been sequenced to an accuracy of 99.99 percent.
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
Answer:
The complementary base pair is ATG TTT GTG ATA TGG CGC ATT TAC TAA
Explanation:
As per the complementary base pairing rule of DNA
C pairs with G and vice versa
A pairs with T (in DNA) or U (in RNA)
Breaking the given strand into triplets, we get -
TAC AAA CAC TAT ACC GCG TAA ATG ATT
ATG TTT GTG ATA TGG CGC ATT TAC TAA
Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash
Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.
Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.
Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.
Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.
Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.
Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.
Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.
Learn more about Biomass at :
https://brainly.com/question/21525417
#SPJ4
Complete question:
1.plants
2.animals
3.animal waste
4.sunlight
5.paper
6.trash
What happens in insertion mutation?
An insertion mutation changes the DNA sequence by adding one or more nucleotides to the gene.
An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and frameshift mutations.
Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.
To learn more about mutation , here
brainly.com/question/17130462
#SPJ4
can some one help me ill give more points if its right. ill give like 50
Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.
Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway
Answer:
Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.
Explanation:
Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.
A sea otter is considered very important in
maintaining his ecosystem and food web.
Changes with him will affect the ecosystem
dramatically. A species such as this is called
a(n).
A. keystone species
B. VIP
C. ecosystem king
How does hypertension cause stroke?
In hypertension, The arteries that carry oxygen and blood to the brain can burst or become blocked by high blood pressure, resulting in a stroke.
There are many ways that high blood pressure can harm your health. It has the potential to seriously harm vital organs like your eyes, brain, kidneys, and heart. Your arteries may become less elastic as a result of high blood pressure, reducing the flow of blood and oxygen to your heart and resulting in heart disease. A stroke can result in severe impairments of speech, movement, and other fundamental activities. You can also die from a stroke.
Know more about hypertension here: https://brainly.com/question/29799896
#SPJ4
What is the probability that two parents with the genotype AaBb will produce an offspring with the genotype AaBb?
The probability of parents with the AaBb genotype producing offspring with the genotype AaBb is 4/16. Thus the correct answer is (b) 4/16.
The Punnett square method is used to forecast the prospective offspring from a certain cross based on the gametes of the parents. The parents carefully create the gametes that are arranged in a checkerboard pattern so they can understand all the potential children that can be generated. The likelihood of each prospective offspring can be determined using the checkerboard method. In the cross, there are four gametes produced by each of the two dihybrid parents. As a result, the hybrid has the capacity to produce a total of 16 offspring. Out of the 16 possible combinations, only four types of offspring can have the AaBb genotype.
Parents: AaBb*AaBb
Genotypes: AB Ab aB ab * AB Ab aB ab
Offspring: ABAB ABAb ABaB ABab AbAB AbAb AbaB Abab aBAB aBAb aBaB aBab abAB abAb abaB abab
Percentage: AaBb: 4/16
The complete question is:
What is the probability of an AaBb offspring when you cross AaBb x AaBb parents?
a. 1/2
b. 4/16
c. 1/8
d. 1/32
e. 1/4
To learn more about cross between parent genotypes please click on the given link: https://brainly.com/question/26601444
#SPJ4
How do glands of the endocrine system help your body maintain homeostasis?
What was the most significant conclusion that Mendel?
The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.
The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.
Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.
The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.
Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.
For more information on Mendel's experiment , visit :
https://brainly.com/question/30097040
#SPJ4
Complete question :
What was the most significant conclusion that Mendel drew from his experiments?
A There is considerable genetic variation in garden pea
B Traits are inherited in discrete units one from each parent
C Genes are composed of DNA
D Recessive genes occur as frequently as dominant ones.
What implications could this have for this species of slug from an evolutionary standpoint? What potential advantages or disadvantages might this mutation have?
Positive mutations are essential for evolution to occur. They raise a living thing's chances of surviving or procreating. Deadly mutations can give rise to cancer or genetic diseases.
Are mutations typically detrimental?While most mutations are beneficial, some can also be dangerous. A dangerous mutation might cause a genetic illness or a cancerous condition. Chromosome-level mutations are still another type. Chromosomes, which are little, threadlike organelles present in the cell nucleus, carry genes.
Why do mutations cause issues?A variation can make a protein malfunction or not be created at all by altering the gene's instructions for producing it. A variation can impair normal development or result in a disease when it changes a protein that is essential to the organism.
To know more about mutations visit:
https://brainly.com/question/17130462
#SPJ1
What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses
Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.
What are genes and what do they do?A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.
What are the four primary roles of genes?Gene functions include:
Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.Learn more about gene functions to visit this link
https://brainly.com/question/8334911
#SPJ4
Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?
Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.
Many viruses specifically methylate protective genes, thus enhancing viral infectivity.
Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.
Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.
how many gender are really there? I believe that there are two male and female but people say that there are like 50
I, and certain humans, not only think or believe but KNOW that there are only two. The end.
I need someone to explain this
Quorum-sensing contributes to the ability of bacterial colonies to congregate into nearly solid masses which act as barriers to effective decontamination and sterilization called:
Biofilms are formed when bacteria congregate into a nearly solid mass. This occurs when bacteria use quorum sensing to communicate with each other and create pathways for cells to attach to and form a matrix.
The matrix shields the cells from external forces and helps to protect the bacteria from antibiotics, desiccation, and extreme temperatures. Biofilms can form on just about any surface, including medical and surgical instruments, water pipes, and even on the surfaces of plants and animals.
The formation of biofilms makes it difficult to decontaminate and sterilize, since the bacteria are protected within the matrix and can withstand harsh chemicals and extreme temperatures. Biofilms are also highly resistant to antibiotics, making them difficult to eradicate.
To learn more about antibiotics visit:
https://brainly.com/question/10868637
#SPJ4
Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.
Answer:
Yes they are wrong
Explanation:
I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.
A DNA s
equence has mutated from
–
AAG G
CA TTC
-
t
o the sequence of
–
AAG GCT ATT C
-
. This mutation is an
example of a/an ___________________?
a.
Frameshift mutation
b.
Point
mutation
c.
Triple shift mutation
d.
Chromosomal
mutation
Answer:
Explanation:
The mutation is from AAG GCA TTC to AAG GCT ATTC
So there is a frameshift with an insertion of a T
Answer is a Frameshift mutation.
Answer:
Explanation:
its an example of single insertion leading to a frameshift mutation
How has the world population changed in the last 200 years?
in details the steps for blood clotting in response to an injury
B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas
Answer:
B) A. FALSO.
B. VERDADERO.
C. VERDADERO.
D. VERDADERO.
c) D. Contracción de los bronquios.
d) A. Axon, dendritas, cuerpo neuronal.
Explanation:
B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.
B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.
C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.
D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.
c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:
D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.
d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:
A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)