A biologist used the radioisotope tritium (3H) to label thymine and the radioisotope carbon-14 (14C) to label uracil. She then incubated a growing bacterial culture with both labeled bases. After five hours of incubation, the biologist extracted polynucleotides from the cells and separated them into three groups, each containing a range of different polynucleotide lengths. The first group contained the shortest polynucleotides. The second group contained polynucleotides of midrange length, and the third group contained the longest polynucleotides. Then she determined the percentage of each radiolabel in each fraction. Her data are summarized in the table above. Which statement represents a reasonable hypothesis that could explain these results?Uptake of 3H label resulted from DNA replication, and uptake of 14C label resulted from transcription.

Answers

Answer 1

The statement that represents a reasonable hypothesis that could explain these results is Uptake of 3H label resulted from DNA replication, and uptake of 14C label resulted from transcription.

The process by which a double-stranded DNA molecule is duplicated to form two identical DNA molecules is known as DNA replication. Replication is necessary because when a cell splits, the two new daughter cells must have the same genetic information, or DNA, as the parent cell.

The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is created when segments of DNA are translated into RNA molecules that can encode proteins. Other DNA sequences are transcribed into RNA molecules known as non-coding RNAs. Only 1-3% of total RNA samples contain mRNA.

To learn more about DNA replication and transcription, here

https://brainly.com/question/30192876

#SPJ4


Related Questions

The definition of biological evolution encompasses

Answers

Answer:

Biological evolution, simply put, is descent with modification. This definition encompasses small-scale evolution (changes in gene frequency in a population from one generation to the next) and large-scale evolution (the descent of different species from a common ancestor over many generations).

Explanation:

Biologists look at how organisms are related and when they first appeared on Earth. Which of the following is true about the organisms that live on Earth today?

A. All organisms that have ever lived on Earth can still be found alive today.

B. Some of the organisms alive today have been around for 4.6 billion years.

C. The organisms alive today are the same as the ones found in fossils.

D. The organisms alive today evolved from organisms that previously lived on Earth.

Answers

Answer:

the organisms alive today evolved from organisms that previously lived on Earth.

Explanation:

nuneeedadoll on IG

The organisms that live on Earth today evolved from organisms that previously lived on Earth.

What is pre existing organism?

The focus of biogenesis states that all living organisms arise from a pre-existing living organism. The theory of biogenesis is given by Louis Pasteur.

The theory said that life comes from pre-existing life, by means of reproduction. Living beings do not arise from non-living things.

Thus, option "D" is correct,  organisms arise from a pre-existing living organism.

To learn more about organisms click here:

https://brainly.com/question/12825206

B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas

Answers

Answer:

B) A. FALSO.  

B. VERDADERO.  

C. VERDADERO.

D. VERDADERO.

c) D. Contracción de los bronquios.

d) A. Axon, dendritas, cuerpo neuronal.

Explanation:

B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.

B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.  

C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.

D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.

c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:

D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.

d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:

A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)

What implications could this have for this species of slug from an evolutionary standpoint? What potential advantages or disadvantages might this mutation have?

Answers

Positive mutations are essential for evolution to occur. They raise a living thing's chances of surviving or procreating. Deadly mutations can give rise to cancer or genetic diseases.

Are mutations typically detrimental?

While most mutations are beneficial, some can also be dangerous. A dangerous mutation might cause a genetic illness or a cancerous condition. Chromosome-level mutations are still another type. Chromosomes, which are little, threadlike organelles present in the cell nucleus, carry genes.

Why do mutations cause issues?

A variation can make a protein malfunction or not be created at all by altering the gene's instructions for producing it. A variation can impair normal development or result in a disease when it changes a protein that is essential to the organism.

To know more about mutations visit:

https://brainly.com/question/17130462

#SPJ1

Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.

Answers

Answer:

Yes they are wrong

Explanation:

I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.

What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses

Answers

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

What are genes and what do they do?

A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.

What are the four primary roles of genes?

Gene functions include:

Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.

Learn more about  gene functions to visit this link

https://brainly.com/question/8334911

#SPJ4

Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

Many viruses specifically methylate protective genes, thus enhancing viral infectivity.

Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.

Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Answers

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Plant seedlings were treated with a range of concentrations of coumarin, a small organic compound. After one week, seedling height was taken as a measure of plant growth. In a separate experiment, stem tissue sections were taken from newly germinated seedlings and incubated in solutions containing 14C-glucose and coumarin. After 24 hours, the quantity of radioactive label in cytoplasmic and cell wall fractions was measured. All data are shown in the table above. Which statement is supported by these results

Answers

Coumarin is found to restrict the production of a specific component found in the cell walls but not in the cytoplasm, which plays an important role in the growth of the stem. (BIOSYNTHESIS< CYTO< STEM GROWTH)

The results from the experiment suggest that coumarin treatment negatively impacts the growth of plant seedlings, as measured by seedling height. This indicates that coumarin has an inhibitory effect on stem growth.

Additionally, the experiment that measured the number of radioactive labels in cytoplasmic and cell wall fractions revealed that coumarin affects the biosynthesis of a specific component in the cell walls but not in the cytoplasm. This suggests that coumarin specifically targets the production of a component that is critical for stem growth, and that this component is found primarily in the cell walls and not in the cytoplasm.

This is further supported by the fact that the radioactive label is found in the cell wall but not in the cytoplasm, indicating that the biosynthesis of this component is taking place in the cell wall and not in the cytoplasm. Overall, these results suggest that coumarin is inhibiting the biosynthesis of a component that is critical for stem growth, specifically in the cell walls.

To learn more about germination at

https://brainly.com/question/15976369?referrer=searchResults

#SPJ4

23. Disposable nonwoven drapes: a. Are impervious to fluid strikethrough b. May be a combination of fluid-resistant and absorbent layers c. Can be reprocessed

Answers

The correct option is B ; May be a combination of fluid-resistant and absorbent layers There are two kinds of surgical drapes: reusable and disposable.

Reusable drapes are comprised of a woven cloth that is washed and sterilized between treatments.  Disposable drapes, on the other hand, are often constructed of non-woven material and are cremated after each operation.

McKesson Field Drape/Towel Non-Fenestrated is sterile and poly-lined, making it suitable for use in operating rooms. This critical medical supply item is used during surgical operations to drape over the body in order to separate the operating field. To prevent bacterial strike-through, the inner poly layer repels moisture.

Learn more about to disposable

https://brainly.com/question/14732695

#SPJ4

Why are vestigial structures not removed by natural selection?

Answers

Structures that have no apparent function and appear to be residual parts from a past ancestor are called vestigial structures. Examples of vestigial structures include the human appendix, the pelvic bone of a snake, and the wings of flightless birds.

How does hypertension cause stroke?

Answers

In hypertension, The arteries that carry oxygen and blood to the brain can burst or become blocked by high blood pressure, resulting in a stroke.

There are many ways that high blood pressure can harm your health. It has the potential to seriously harm vital organs like your eyes, brain, kidneys, and heart. Your arteries may become less elastic as a result of high blood pressure, reducing the flow of blood and oxygen to your heart and resulting in heart disease. A stroke can result in severe impairments of speech, movement, and other fundamental activities. You can also die from a stroke.

Know more about hypertension here: https://brainly.com/question/29799896

#SPJ4

Look at this picture. Is this bird about to become this predator’s lunch? What do you think is happening in this photo?

Answers

Answer:

I don't think it is becoming the predator lunch. there are some birds who will clean the teeth

the bird is cleaning it’s teeth. It’s called mutualism

what is the ratio of 15 minutes to 2 hours​

Answers

Answer:

15mins : 2 hrs

15 mins : 120 mins

1 : 8

Answer:

1:8

Explanation:

Convert 2 hours to minutes:

60*2 = 120 minutes

15/120 = 1:8

A sea otter is considered very important in
maintaining his ecosystem and food web.
Changes with him will affect the ecosystem
dramatically. A species such as this is called
a(n).
A. keystone species
B. VIP
C. ecosystem king

Answers

The answer would be Key stone species

What is the great red spot on Jupiter
A. Hurricane
B. Thunderstorm
C. Bad Weather
D.Tornado

Answers

b.thunderstorm it has really bad winds and rain
a thunderstorm is the answer

What is the probability that two parents with the genotype AaBb will produce an offspring with the genotype AaBb?

Answers

The probability of parents with the AaBb genotype producing offspring with the genotype AaBb is 4/16. Thus the correct answer is (b) 4/16.

The Punnett square method is used to forecast the prospective offspring from a certain cross based on the gametes of the parents. The parents carefully create the gametes that are arranged in a checkerboard pattern so they can understand all the potential children that can be generated. The likelihood of each prospective offspring can be determined using the checkerboard method. In the cross, there are four gametes produced by each of the two dihybrid parents. As a result, the hybrid has the capacity to produce a total of 16 offspring. Out of the 16 possible combinations, only four types of offspring can have the AaBb genotype.

Parents: AaBb*AaBb

Genotypes: AB   Ab    aB   ab *  AB    Ab   aB   ab

Offspring:   ABAB    ABAb   ABaB   ABab   AbAB   AbAb  AbaB  Abab  aBAB   aBAb   aBaB   aBab   abAB  abAb  abaB  abab

Percentage: AaBb: 4/16

The complete question is:

What is the probability of an AaBb offspring when you cross AaBb x AaBb parents?

a. 1/2

b. 4/16

c. 1/8

d. 1/32

e. 1/4

To learn more about cross between parent genotypes please click on the given link: https://brainly.com/question/26601444

#SPJ4

PBS Evolution: Great Transformations

1. If the world’s history were compressed into one hour, how long have humans been here?

Microbes. Single-celled organisms


2. How long ago did mammals first appear on earth?

Mammals first appeared about 200 million years ago

3. What type of animal did the skull that Dr. Gingrich discovered resemble?

Dr. Gingrich discovered resembled a whale

4. What did "Whale Valley" used to be?

Whale valley is a


5. What unusual feature did they find at the end of the early tetrapods’ limbs?


6. How long ago did animals first appear on Earth?


7. When the mouse "eyeless" gene was implanted into the fruit flies, what happened?


8. How would walking on two legs be an advantage?


9. What modifications does the human skeleton have?

Humans has the same transformation as other animals even though humans are special.


10. Summary/reflection:

Answers

Given that whales and other mammals resembled other mammals in terms of their skulls and other sculptures, based on the fossil evidence, humans have undergone evolutionary transitions.

The transition from land animals to whales is one of the most well-known instances of a supposed change cited by the evolution contingency in the opening of the program. The fossils of Pakicetus, Ambulocetus, Rhodocetus, Dorontid, and Basilosaurus show that this transition can be explained. Pakicetus only has a small portion of its cranium to display, as opposed to a whole transitional fossil.

The program portrays Ambulocetus as a fully preserved fossil of an aquatic mammal with legs, yet this is a stretch of the fact because the animal's skeleton was actually discovered to be extremely fragmented. Rhodocetus is solely represented in the series by a skull.

To know more about evolution, refer to the following link:

https://brainly.com/question/27748371

#SPJ4

how dors raising the temperature affect the rate of nuclear decay

HELP ASAP DYE TMRRW

Answers

Unlike chemical reaction rates, which vary with the conditions of a reaction, nuclear decay rates are constant..Raising the temperature has no effect on the rate of nuclear decay.

How does temperature impact the rate of decay?

Decomposing organisms are less active in cooler temperatures, keeping the pace of decomposition low.

How is nuclear decay influenced by temperature?

A speed of alpha, beta, & electron decays all rely on temperature & whether they are contained inside an insulating or conducting material, as demonstrated by numerous groups.

To know more about nuclear decay visit:

https://brainly.com/question/12224278

#SPJ1

How do glands of the endocrine system help your body maintain homeostasis?

Answers

The glands of the endocrine system secrete hormones into the bloodstream to maintain homeostasis and regulate metabolism. The hypothalamus and the pituitary gland are the command and control centers, directing hormones to other glands and throughout the body.

can some one help me ill give more points if its right. ill give like 50

Answers

Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.

Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway

Answer:

Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.

Explanation:

Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.

Han’s younger sister is riding her tricycle in a straight line. Her speed is 2.5 m/s. After 5 seconds, she comes to a stop. What is her acceleration during this time? (Hint: when she comes to a stop her speed will be 0 m/s).

Answers

-0.5m/s^2

Explanation:

the answer is negative this only show direction that is acceleration is a vector quantity

periodic table of elements an atom contains 11 protons and 12 neutrons, its atomic number will be_ and the mass number will be _.

a 1, 23
b 11, 23
c 12, 11
d 23, 11

Answers

Answer: the atomic number is eleven because the number of protons is equal to the number of electrons which is also equal to the atomic number.

The atomic mass is the protons+neutrons which after adding will give 23.

Explanation:

What happens in insertion mutation?

Answers

An insertion mutation changes the DNA sequence by adding one or more nucleotides to the gene.

An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and frameshift mutations.

Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.

To learn more about mutation , here

brainly.com/question/17130462

#SPJ4

Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash

Answers

Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.

Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.

Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.

Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.

Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.

Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.

Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.

Learn more about Biomass at :

https://brainly.com/question/21525417

#SPJ4

Complete question:

1.plants

2.animals

3.animal waste

4.sunlight

5.paper

6.trash

Why isn't glycolysis considered a closed pathway?

Answers

Glycolysis is not considered a closed pathway because it consumes energy in the form of adenosine triphosphate (ATP) and generates energy in the form of adenosine diphosphate (ADP) and a high-energy phosphate group. Additionally, the intermediates of glycolysis, such as glucose and pyruvate, can be used in other metabolic pathways.

The occurrence of transitional fossils supports the idea that (select all that apply)Group of answer choices extinct and living forms are related.these are ancestors of living species.change occurs in species over time.

Answers

The occurrence of transitional fossils supports the idea that - extinct and living forms are related, these are ancestors of living species, change occurs in species over time.

A transitional fossil is that  fossilized remains of a life form which exhibits traits common to both an ancestral group and its derived descendant group which is living at present. The descendant group is sharply differentiated by gross anatomy and mode of living from the ancestral group.

These fossils show that taxonomic divisions are human made that have been superimposed on the continuum of variation. Because of the incompleteness and unavailability of the fossil record, there is usually no way to know exactly how close a transitional fossil is to the point of divergence if evolution of that particular species. Therefore, it cannot be assumed that transitional fossils are direct ancestors of more recent groups, though they are frequently used as models for such ancestors.

For further learning about transitional fossils ,follow the link:

https://brainly.com/question/7156308

#SPJ4

What does the grey layer(clay) do in
the soil profile?

Answers

In deeper horizons such as the B-horizon, a brown colour usually means that the soil has good natural drainage. A black or dark grey colour usually comes from an accumulation of organic matter. In areas of high rainfall, this may again mean poor drainage.

What is the advantage of cells being so small?

A. Small cells contain a greater quantity of enzymes than large cells.

B. Small cells do not require energy and get everything they need from osmosis.

C. The cell has a smaller surface area to volume ratio which means it can move nutrients into
the cell and waste out more efficiently.

D. The cell then has a larger surface area to volume ratio which means it can move nutrients
into the cell and waste out more efficiently.

Answers

Answer:

D. The cell then has a larger surface area to volume ratio which means it can move nutrients into the cell and waste out more efficiently.

Explanation:

What would happen to the population of snakes and rabbits if hawks were removed from the ecosystem?

Answers

There would be a HUGE increase to their species, because their predator would be gone. And the snakes and rabbits pray would have a huge decrease because there would be more snakes and rabbits that would eat them.

A DNA s
equence has mutated from

AAG G
CA TTC
-
t
o the sequence of

AAG GCT ATT C
-
. This mutation is an
example of a/an ___________________?
a.
Frameshift mutation
b.
Point
mutation
c.
Triple shift mutation
d.
Chromosomal
mutation

Answers

Answer:

Explanation:

The mutation is from AAG GCA TTC to AAG GCT ATTC

So there is a frameshift with an insertion of a T

Answer is a Frameshift mutation.

Answer:

Explanation:

its an example of single insertion leading to a frameshift mutation

Other Questions
what class of people in the 1800s were doctors Which of the following would not be an example of a compound event?(1) having a coin land on heads three consecutive times(2) pulling a king out of a deck of cards(3) missing two free throws in a row(4) answering four true/false questions correctly by guessing Would this equal 0 (zero): (put yes/no as your answer)Sandy's rose bush grew 8 inches in the spring. Then, she pruned it back 8 inches in the fall.I need help ASAP!!!!!!!!! Plz & thx. I will give the correct answer a crown.Also, have a great day/night How did the Catholic Church get so rich? N plus 75 used in a real world sentence. Please make in own words please i beg you. Read the article titled Baseball in Japan. How was baseball first introduced to Japan? Why did the Allies encourage its continuation in Japan after the war? Two-fifths of a number is 2/5 greater than 1/3 of the number. What is the number? Drag each label to the correct location. Identify each character stick with either the Russian or the western European social structure at the time of the Crimean war. Surfs from majority of the population agricultural economy modern military constitutional monarchy industrial economy absolute monarchy outdated military no serfs 1. What is the rhetorical situation in which Anzaldua finds her- self using different language forms? (Rhetorical situation refers to the contextintended audienceand for writing 6. Name the polygon. Write whether it is regularor not regular WHAT IS MEANT BY BJT AND FUNCTION OF BJT help i have 5 mins left I don't get the problem! No links please! What factor encouraged a significant migration to Jefferson County, Texas in 1901?a. Promise of religious freedomb. Discovery of oil reservesc. Sale of inexpensive landd. Employment of ranch hands "The would-be black savant was confronted by the paradox that theknowledge his people needed was a twice-told tale to his white neighbors,while the knowledge which would teach the white world was Greek to hisown flesh and blood. The innate love of harmony and beauty that set theruder souls of his people a-dancing and a-singing raised but confusion anddoubt in the soul of the black artist; for the beauty revealed to him was thesoul-beauty of a race which his larger audience despised, and he could notarticulate the message of another people." This quote from the lastparagraph of this excerpt can be seen as an explanation of the need for theHarlem Renaissance. Which of the following would be the bestjustification?A The art that Black people created seemed to only be understood by Black peopleB Even though White audiences despised Black expressions of art, Black people stillneeded to create itC The love of harmony and beauty were driving forces for Black art to be createdD All of the above Jake says "Exact. Je dis we run for it. We can voler de nouveau to Moscou et remettre les oeufs. With tous thesegens alentour, nous pouvons dfinitivement get away."What does voler mean in this sentence?O returnO stealO goO fly The height of the apple trees in an orchard are normally distributed with a mean of 12.5 feet and a standard deviation of 1.2 feet what percentage of the apple trees are taller than 14.9 ft Egalitarian societies depend on sharing which of the following in order to ensure group success? a. children b. resources c. weaponry d. sexual partners. how do i do this question King Street Corporation has a pre-credit U.S. tax of $119,000 on $514,000 of taxable income. The company has $220,000 of foreign source taxable income and paid $74,000 of income taxes to the Italian government on this income. All of the foreign source income is treated as foreign branch income for foreign tax credit purposes. Calculate the company's foreign tax credit on its tax return will be: (Do not round intermediate calculations. Round your answer to nearest whole dollar amount.)