Are mouse cells eukaryotic or prokaryotic?

Answers

Answer 1

Answer:

Eukaryotic

Explanation:


Related Questions

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

Viral DNA that is integrated into a bacterial chromosome is a

Answers

Answer:

Hidden virus.

Explanation:

It will sit in the cell's DNA for a while and then attack.

Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy

Answers

Answer:

A. Advanced Decision analysis

Explanation:

Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.

Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.

Answer:

Advanced decision analysis

Explanation:

I took the quiz on edge

When and how were the first trans fats made with vegetable oil?

Answers

Answer:

Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.

Why do you think the size of a white dwarft affects its visual luminosity?

Answers

The bigger the size the more easier to see from a distance and the smaller the harder to see from a distance

Answer:

White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.

Explanation:

The __________ variable in an experiment is the one that the scientist intentionally changes in an experiment. The _______ variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called _______

Answers

Answer:

idependent#1dependent#2and control variable is #3

Explanation:

The indwpendent variable in an experiment is the one that the scientist intentionally changes in an experiment. The dependent variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called Conttol variable

are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it

Answers

Answer:

C. Steroids

Explanation:

Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.

Answer:

steroids

Explanation:

so c

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:

Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?

Answers

Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.

In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.

Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.

The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

Learn more here: https://brainly.com/question/2088739

Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?

Answers

Answer:

Are you against or with?

Explanation:

,.;1q23wt4y5eu6ri7ertyur

why are index fossils useful to geologist

a.they tell the relative age of the rock in which they occur

b. they tell the ages of many different rock layers

c.they tell the age of the rock at one location only

d. they tell the absolute age of the rock in which they occur

Answers

Answer:

Explanation:

Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.

Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x

Answers

Answer:

B is the correct answer

Explanation:

4x10=40

I need help for this one

Answers

Answer:

Cl2

Explanation:

Answer: Cl2           Hope this helps!

Explanation:

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

4a. Describe two examples of non-living things that have one or more of these characteristics of
life.

Answers

Answer:

Water and Air

Explanation:

Water and air both are missing cells that living things have.

What properties of carbon explain carbon’s ability to form different large and complex structures?

Answers

Carbon is four valence electrons they bond to the other carbon atoms

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?​

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water


Observing Footprints from the Past
detective"O" (observation) or I (inference)

Answers

Answer:

dfvas

Explanation:

sadvadsssssss

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as...  Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

describes natural selection?

Answers

Simply, natural selection is that the genetically strongest organisms will be the ones that are able to survive and reproduce, which eliminates weak characteristics, and keeps the strong ones. Survival of the fittest.

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

plz help I will mark you brainlist plz ​

Answers

Answer:

1. Acid

2.  Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)  

10. acid

*Anybody correct me if I'm wrong*

Explanation:

Other Questions
What organelle are in red blood cells TRUE or FALSE: Informational texts are a type of fiction.True or False The formulas below are the cost and revenue functions for a company that manufactures and sells small radios.C(x)= 64,000 + 45x and R(x) = 49xa. Use the formulas shown to write the company's profit function, P, from producing and selling x radios.b. Find the company's profit if 24,000 radios are produced and sold.a. The company's profit function is P(x) =(Simplify your answer.) Because they were brilliant mathematicians and astronomers, the Mayans accurately predictedO weatherO falling starsO solar eclipsesO volcanic eruptions Why do electrons flow in a circuit What are the two types of triangles used in drafting?A. 45 degree and 90 degreeB. 45 degree and 30 degreeC. 90 degree and 30 degreeD. 30 degree and 60 degree may you please help me? All of the following countries had colonies in North America except.5 pointsA. FranceB. PolandC. SwedenD. Spain In a group of students, 30 played chess, 19 played volleyball, 25 playedbasketball, 14 played both volleyball and chess, 8 played both baskethalland volleyball, 15 played both basketball and chess and 5 played boththree events. How many played chess only, basketball only and volleyballonly? How many students are there in all? Whats the diameter of a circle 5in what doctors/bone doctors treats Osteonecrosis? The passage reveals which of the following trends from the period 1200 to 1450?A. Widespread hostility toward trade with outsiders was being supported by the state.B. The state was sponsoring innovative commercial practices and infrastructure to encourage trade.C. Luxury goods and products became accessible to the middle and lower classes.D. Economies were declining throughout Eurasia as a result of Mongol invasions.Refer to the passage.Furthermore all merchants arriving from India or other countries, and bringing with them gold or silver or gems and pearls, are prohibited from selling to any one but the Emperor. He has twelve experts chosen for this business, men of shrewdness and experience in such affairs; these appraise the articles, and the Emperor then pays a liberal price for them in those pieces of paper. The merchants accept his price readily, for in the first place they would not get so good a one from anybody else, and secondly they are paid without any delay. And with this paper-money they can buy what they like anywhere over the Empire, whilst it is also vastly lighter to carry about on their journeys. And it is a truth that the merchants will several times in the year bring wares to the amount of 400,000 bezants, and the Grand Sire pays for all in that paper. Excerpt from The Book of Ser Marco Polo, the Venetian, Concerning Kingdoms and Marvels of the East, Vol. 2, 1871 Look at the map.Which feature does the highlighted area on the map show?O Chesapeake Baythe Appalachian Mountains which number represents the red river ,an important border barrier? select one:5423 Do you believe that global free trade has done more harm than good. HELP PLEASE ASAP Explain the advantages gained by studying plants using the groups and classifications commonly used by commercialgrowers. SOLVE NUMBER TWO I WILL GIVE BRAINLIST!! USE PIE PLEASE. Help needed ASAP will give you brainliest and 5 STARS RATE Someone please help me What are two substances that are useful because of their viscosity? (Please describe why they are useful)