¿Cómo se manifestaron los ismos de lavanguardia en la literatura en América latina?

Answers

Answer 1
how did the isms of the avant-garde manifest themselves in Latin American literature?

Related Questions

plzzz help thank you guys sm!

Answers

1-Me gustaría ver un juego de fútbol en Latinoamérica

2-Viajaré con mi amiga Ana

3-Me quedaré 2 semanas en Latinoamérica

4--Me alojaré en un hotel

5-Desde mi habitación tendré vistas al mar

6-Mr levantaría a las 7:30 a.m.

El Hermano Pedro is known for becoming a ______

Answers

Answer: this is what i fould Hermano Pedro de San José Betancur was born on March 21, 1626, in Vilafor on the island of Tenerife in the Canary Islands. After working as a shepherd until his early 20s, he set out for Guatemala, hoping to find a relative there. ... He then became a Franciscan tertiary and took the name Pedro de San José.

Hope it helps

Explanation:

please help me with this spanish! I'd appreciate it a lot

Answers

Answers

7. B

8. B

Explanation

They are both B

Explanation:

I am hispanic.

Need help with Spanish pleaseee

Answers

Answer:  me pongo

Explanation: You put yourself to do something so (pongo)

En mi tiempo libre me pongo a tocar la guitarra y jugar baloncesto

You can pick a task pints and extra points and also i have lots of works as questions and also some of answers.Thanks let me know. Have a wonderful day!:)What spanish word mean pollution?

Answers

Answer:

contaminacion?

The Spanish word for pollution is: Contaminación

how many supporters met chavez and his fellow marchers at the end of their pilgrimage

Answers

Chavez and a group of strikers set out on a 340-mile march from Delano to Sacramento to draw attention to plight of farm workers Thousands of supporters joined the marchers.

Complete with the correct preterite verb form.WILL BRAINLIST IF CORRECT, will report if scam!

Answers

1) Yo hable con Juan ayer
Cuando tu hablaste con Juan

2) Yo tome un examen
En que clase tomaste el examen

3) Yo lo compre ayer
Cuando lo compraste tu

4) Nosotros nadamos en el mar
Y ustedes nadaron en la pisina

5) Nosotros pagamos cien pesos
Cuanto pagaron ustedes

6) Que pistas bajaron ustedes?
Nosotros bajamos las pistas para participantes

someone pls help me
will mark u brainliest

Answers

1:D
2:F
3:E
4:C
5:A
6:B
7:G
1.f
2.d
3.e
4.g
5.a
6.b
7.c
Hope this helps
Please mark brainliest
Tell me if this is wrong please
Have a good day .;)

Plzzzz help answer these questions

Answers

Give me brainliest quick and message me and I’ll give you awnsers for the next 5 minutos

translate pls
No somos extraños para amar
Tu conoces las reglas y yo también

Un compromiso total es lo que estoy pensando

No obtendrías esto de ningún otro chico

Solo quiero decirte como me siento

Tengo que hacerte entender

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Nunca te haré llorar, nunca te diré adiós

Nunca diré una mentira y te lastimaré

Nos conocemos desde hace tanto tiempo

Te duele el corazón pero eres demasiado tímido para decirlo

Por dentro, ambos sabemos lo que ha estado pasando

Conocemos el juego y lo vamos a jugar

Y si me preguntas como me siento

No me digas que eres demasiado ciego para ver

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Nunca te haré llorar, nunca te diré adiós

Nunca diré una mentira y te lastimaré

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Nunca te haré llorar, nunca te diré adiós

Nunca diré una mentira y te lastimaré

Ooh, te rindo

Ooh, te rindo

(Ooh) Nunca me rendiré, nunca me rendiré (Te rendiré)

(Ooh) Nunca me rendiré, nunca me rendiré (Te rendiré)

Nos conocemos desde hace tanto tiempo

Te duele el corazón pero eres demasiado tímido para decirlo

Por dentro, ambos sabemos lo que ha estado pasando

Conocemos el juego y lo vamos a jugar

Solo quiero decirte como me siento

Tengo que hacerte entender

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Nunca te haré llorar, nunca te diré adiós

Nunca diré una mentira y te lastimaré

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Nunca te haré llorar, nunca te diré adiós

Nunca diré una mentira y te lastimaré

Nunca te rendiré, nunca te decepcionaré

Nunca voy a correr y abandonarte

Acabas de tener a rick enrollado

Answers

Answer:

We are not strangers to love

You know the rules and so do I

A total commitment is what I'm thinking

You wouldn't get this from no other guy

I just want to tell you how I feel

I have to make you understand

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

We've known each other for so long

Your heart hurts but you're too shy to say

Inside we both know what's been going on

We know the game and we are going to play it

And if you ask me how I feel

Don't tell me you're too blind to see

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

Ooh, I surrender to you

Ooh, I surrender to you

(Ooh) I'll never give up, I'll never give up (I'll give up on you)

(Ooh) I'll never give up, I'll never give up (I'll give up on you)

We've known each other for so long

Your heart hurts but you're too shy to say

Inside we both know what's been going on

We know the game and we are going to play it

I just want to tell you how I feel

I have to make you understand

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

You just had rick rolled up

Answer:

We are not strangers to love

You know the rules and so do I

A total commitment is what I'm thinking

You wouldn't get this from no other guy

I just want to tell you how I feel

I have to make you understand

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

We've known each other for so long

Your heart hurts but you're too shy to say

Inside we both know what's been going on

We know the game and we are going to play it

And if you ask me how I feel

Don't tell me you're too blind to see

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

Ooh, I surrender to you

Ooh, I surrender to you

(Ooh) I'll never give up, I'll never give up (I'll give up on you)

(Ooh) I'll never give up, I'll never give up (I'll give up on you)

We've known each other for so long

Your heart hurts but you're too shy to say

Inside we both know what's been going on

We know the game and we are going to play it

I just want to tell you how I feel

I have to make you understand

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

I will never make you cry, I will never say goodbye

I will never tell a lie and hurt you

I will never give you up, I will never let you down

I will never run and abandon you

You just got rick rolled

Explanation:

When I read the first sentence and translated it to english and then I started to read and translate a few I realized. That was really well placed.

PLEASE HELP ME ASAP

NO LINKS PLEASE

Answers

Answer:

1. Mi hermano es menor que mi padre

2. Me gusta la clase de español menos que la de ingles.

3. Tu eres mayor tanto como tu amigo(a).

4. Tus primos so mejores tanto como tu.

PLEASEEEEE HELPPPPP ASAPPPPP

Answers

tema:

[tex] \bold{SPANISH}[/tex]

oraciones 1. Alfredo esta buscando las tazas Alfredo esta buscándolas tazas 2.maria y Fernando están preparando la cómidamaria y Fernando están preparandola cómida3.estamos adornado el cuartoestámos adornando el cuarto4carlos está limpiando la cocinacarlos está limpiandola cocina6.mis hermanos están haciendo la tareamis hermanos están haciendola tarea7.yo estoy colgando los abrigosyo estoy colgando los abrigos8. estamos haciendo juntos los trabajos de la casa estamos haciendo juntos los trabajos de la casa BRAINLYMENTALMENTE

SALUDOS CORDIALES

Cientos de personas comenzaron a protestar contra la censura. Completa los comentarios de algunos manifestantes. Utiliza el presente de subjuntivo o el pretérito perfecto del subjuntivo, según corresponda.

Questions
Question 1 with 1 blank
"Es increíble que en el siglo XXI se 1 of 1
(prohibir) una película."
Question 2 with 2 blanks
"Es necesario que 1 of 2
(existir) un sólo tipo de censura: pedimos que se 2 of 2
(prohibir) la censura."
Question 3 with 1 blank
"Esperamos que el Instituto 1 of 1
(revisar) su decisión en la reunión que acaba de terminar."
Question 4 with 1 blank
"Esperamos también que en la reunión se 1 of 1
(reconsiderar) la censura."
Question 5 with 2 blanks
"Ojalá que esta mañana los miembros del Instituto 1 of 2
(reflexionar) más profundamente sobre esta situación y que 2 of 2
(decidir) renunciar a sus cargos."
Question 6 with 2 blanks
"Preferimos que de ahora en adelante el Instituto Cinematográfico 1 of 2
(elegir) miembros que 2 of 2
(defender) la libertad de expresión."

Answers

Answer:

Cientos de personas comenzaron a protestar contra la censura. Completa los comentarios de algunos manifestantes. Utiliza el presente de subjuntivo o el pretérito perfecto del subjuntivo, según corresponda.

Questions

Question 1 with 1 blank

"Es increíble que en el siglo XXI se 1 of 1

(prohibir) una película."

Question 2 with 2 blanks

"Es necesario que 1 of 2

(existir) un sólo tipo de censura: pedimos que se 2 of 2

(prohibir) la censura."

Question 3 with 1 blank

"Esperamos que el Instituto 1 of 1

(revisar) su decisión en la reunión que acaba de terminar."

Question 4 with 1 blank

"Esperamos también que en la reunión se 1 of 1

(reconsiderar) la censura."

Question 5 with 2 blanks

"Ojalá que esta mañana los miembros del Instituto 1 of 2

(reflexionar) más profundamente sobre esta situación y que 2 of 2

(decidir) renunciar a sus cargos."

Question 6 with 2 blanks

"Preferimos que de ahora en adelante el Instituto Cinematográfico 1 of 2

(elegir) miembros que 2 of 2

(defender) la libertad de expresión."

Aunque había (________)

A. Clear
B. unclear)

muchas personas en las calles, los camiones entaron (________)

A. clear
B. unclear

en Buñol para traer los tomates​

Answers

Answer:

b.a..............................

verbo ir
ta (letter) y escribe las form
17 de julio
Querida Sonia
¿Cómo estás? Yo, bien. Generalmente paso tiempo
en casa los fines de semana, pero a veces yo 1 a
Portillo con la familla para esquiar. Hace mucho frío
ali y por eso mi "mama" chilena no
2. siempre con
nosotros En Portillo hay una escuela para los esquiadores
y muchos chicos simpáticos 3. a las lecciones.
También hay un cibercafé con computadoras. Muchas
personas 4... allí para pasar tiempo con los amigos,
Nosotros 5. el domingo. Y tú, < 6. a la playa
todos los días con tus amigos?
Hasta luego,
Maria
180

Answers

Answer:

voyvavanvanvamosvas

Explanation:

PLEASE PLEASE HELP
THIS IS SPANISH

ILL MARK U BRAINLIEST

Answers

Answer:

1.) sucia

2.) sucio or desordenada

3.) triste

Explanation:

1.) dirty

2.) dirty or messy

3.) sad

Yo no
(entender, e-ie).
Mi padre siempre
(perder, i-ie) las llaves.
¿A qué hora
(volver, o-ue) ellas a casa?
Nosotros
(jugar, u-ue) volibol.
. Yo
(venir, e-ie) a la escuela hoy.

Answers

•Yo no entiendo.

•Mi padre siempre pierde.

•A que hora vuelven ellas a casa?

•Yo voy a la escuela hot.

Answer:

entiendo

pierde

vuelven

jugamos

viene

Explanation:

Las mujeres _____ el agua (beber) imperfect tense

Answers

La mujeres beben el agua
La mujeres beben el agua

CAN SOMEBODY HELP WITH MY SPANISH ALSO READ THE QUESTION PLZZ:((

Answers

Answer: 2.fueron 3.fui 5.fuimos 6.fueron 7.fue 9.fueron 10.fuisteis 12.fueron 13.fue

Explanation:

Answer:

Explanation:

erafueronfuieranfuimosfuefuefuefueronfuistefueronfueronfue


Will give brainliest! Please help

Answers

Answer: you can say for number 36. voy a ser mi tarea 37. say - yo ey mis amigos vamos corer a un playa ey vamos nadar. 38. pon tu tabla ey tu lapiz en tu mochila. 39. La ninia se va ayir a dormir. 40. as tu cuarto ey limpia to cama

Explanation:

Prompt
Drawing from the following pictographs, write ten command phrases. Each phrase must use at least two of the commands, so for example, you could write: "¡Cante y encienda la luz!" but not just "¡Cante!"



*Note: This is a practice activity. Completing this activity will not only prepare you for future tests and assessments but, more importantly, it will enhance your language ability. This activity will not count towards your grade.

Answers

Explanation:

Dame el teléfono y cierro la puerta.

Ve a tu hermano y su club para lidiar con la comida.

Tu hermana está enferma, ve y trae un medicamento, y no demoras.

Please anwser this quick

Answers

Answer:

habla

Explanation:

Answer: 1.b
And for number 2.d

Bolívar siempre ___________ con la creación de una confederación de naciones.
A. soñábamos
B. soñaste
C. soñamos
D. soñaba

Answers

It would probably be c

Answer:

D. Sonaba

Explanation:

Plato Answer :)

Fill in the blank with the correct form of SER or ESTAR
Nosotros ________________ americanos.

Answers

Answer:

somos

Explanation:

Answer: somos

Explanation:

can someone please translate my english into spanish without using a translator

hi my name is madyson. i have five people in my family. i have two sisters, my mom, and my dad. my sisters names are lylli and grace. they are twelve and seven. my parents names are thomas and ashley. they are thirty six and thirty five. on the weekends my family and i go out to eat.

Answers

Answer:

Explanation:

Hola mi nombre es Madyson. Yo tengo cinco personas en mi familia. Tengo dos hermanas, my mama, y mi papa.(add accent mark on the last a of mama y papa) Mis hermanas se llaman Lylli y Grace. Tienen doce y siete anos. Mis padres se llaman Thomas y Ashley. Ellos tienen treinta y seis y treinta y cinco anos . En los fines de semana mi familia y yo vamos a comer.

Answer: Hola, mi nombre es Madyson. Yo tengo cinco personas en mi familia. Yo tengo dos hermanas, una madre e un padre. Mi hermana’s nombres son Lylii e Grace, ellos son sete e doce. Mi padre e mi madre se chamán Thomas e Ashley. Mi padre es treinta y seis e mi madre es treinta y cinco. En los fines de semana yo e mi familia vámonos comer juntos.

1. (01.01 LC)
Escoge la mejor opción para completar la frase con las palabras correctas. Choose the best option to complete the sentence with the correct words.
El azabache ayuda a proteger contra
(1 point)
la santeria
O la religión católica
o el mal de ojo
el amuleto

Answers

Answer:

o el mal de ojo

Explanation:

El azabache ayuda a proteger contra:

el mal de ojo.

uno de los escenarios donde empezó a codearse el vallenato con la música que Escucha y bailaba La burguesía valses mazurcas canciones napolitanas fue el de la colita
Qué superestructura tiene​

Answers

Answer:

luk7ielo.;kre6i7u

Explanation:

ytufligjkbhjgctuyg

In the bars, on the streets, in the buses, music is everywhere in Colombia. Cumbia, salsa and reggaeton are among the favorite styles, but vallenato reigns supreme. The genre originates from Colombia’s Caribbean coast and blends African, European and indigenous cultures. A highly lyrical and expressive musical form, vallenato even inspired the Nobel Prize-winning author Gabriel García Márquez.

HEY CAN ANYONE PLS PLS PLS ANSWER SPANISH WORK!!!

Answers

Answer:

Explanation:

1 comprende

2 comemos

3 bebo

4 comparten

5 comprenden

6 ves

7 vivimos

8 bebe

9 lee

10 come

11 comparte

12 veo

13 comes

14 bebemos

15 corren

16 ve

17 viven

18 vive

6. Yo no
(entender, e-ie).
7. Mi padre siempre
(perder, i-ie) las llaves.
8. ¿A qué hora
_(volver, o-ue) ellas a casa?
9. Nosotros
(jugar, u-ue) volibol.
10. Yo
_(venir, e-ie) a la escuela hoy.

Answers

Answer:

Explanation:

6 entiendo

7 pierde

8 vuelven

9 jugamos

10 vengo

PLS HELP ILL MARK BRAINLIST!! does anyone know how to put these in future tense??

Answers

Answer:

mhhh lets see no hahaha

Explanation:

wait explain what i have to do and the. I’ll tell u im hispanic and understand Spanish perfectly
Other Questions
Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased 5. The following are energy releasing phase changes EXCEPTA. Condensation B. Freezing C. Deposition D. Sublimation Can someone help please what are some quotes that show romeo's actions/attitudes in romeo and juliet?i need 5 in total, please help In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine need help please12(4 + 8) + 12 Will mark brainliestCould you help me right this in my own words?The Metropolitan Museum of Art was established in 1870 by a group of American citizensbusinessmen and financiers as well as leading artists and thinkers of the daywho wanted to create a museum to bring art and education to the American people. On this day, in 1870, the museum was officially organized and soon after acquired its first work of art: a Roman sarcophagus.