For which equation does n= 7?
2n = 3
n+ 4 = 7
4n = 4
n-4=7

Answers

Answer 1

Answer:

does 1+1 still =2

Step-by-step explanation:

i hope so


Related Questions

what is 200x350+23-7

Answers

Answer:

70,016

Step-by-step explanation:

PEMDAS (parenthesis, exponents, multiplication, division, addition, subtraction)

for this problem, we have to multiply first!

1) 200 x 350 = 70000

now we have ------> 70,000 + 23 - 7

we just have to work left to right

2) 70,023 - 7

3) 70,016

let me know if you have any other questions!

HELP ASAP 100 POINTS!
Solve 2(1 – x) > 2x.
x < 2
x < 0.5
x > 0.5
x > 2

Answers

Answer:

x<0.5

Step-by-step explanation:

Hello lzukuXKachan!

[tex] \huge \boxed{\mathbb{QUESTION} \downarrow}[/tex]

Solve 2(1 – x) > 2x.

x < 2

x < 0.5

x > 0.5

x > 2

[tex] \large \boxed{\mathfrak{Answer \: with \: Explanation} \downarrow}[/tex]

[tex]2 ( 1 - x ) \gt 2 x[/tex]

Firstly, cancel out 2 from both sides of the equation. Now, the equation will be....

[tex]1 - x > x[/tex]

Now, subtract x from both sides.

[tex]1 - x - x > 0[/tex]

Combine -x & -x. It'll be one -2x.

[tex]1-2x>0 [/tex]

Again subtract 1 from both the sides. Remember :- any number subtracted from 0 will result in its negation

So, it'll be -1.

[tex]-2x>-1 [/tex]

Divide both sides by -2.

[tex]x<\frac{-1}{-2} \\ [/tex]

Remove the negative signs. (negative ÷ negative = positive)

[tex]x<\frac{1}{2} \\ = \large\boxed{ \boxed{ \bf \: x < 0.5}}[/tex]

__________________

Hope it'll help you!

ℓucαzz ッ

compounds are pure substances. What other substances are considered pure substances? A: chemical reactions B: elements C: mixtures D: solutions

Answers

Answer:

Step-by-step explanation:

B

Alice earns $185 for working 14.8 hours each week. How much money will Alice earn if she increased her hours to 18 1/2 hours per week?

Answers

:)

Step-by-step explanation:

185 is to 14.8 as x is to 18.5

 

185/14.8 = x/18.5

 

x = 185(18.5)/14.8

 

x = $231.25

answer the question with clear explanation !!

Answers

[tex]food = \frac{1}{3} \times 48000 = 16000 \\ rent = \frac{1}{5} \times 48000 = 9600 \\ clothes = \frac{1}{4} \times 48000 = 12000 \\ food + rent + clothes = x \\ 16000 + 9600 + 12000 = 37600 \\ ndagune \: income - what \: he \: spends = what \: he \: saves \\ 48000 - 37600 = 10400 \\ ndagune \: saves \: 10400[/tex]

A. Integer

B. Rational Number

C. Natural Number

D. Irrational Number

Answers

Answer:

b

Step-by-step explanation:

b b b b b b b b b b b b b b b b b b b b b b b b

Evaluate a2b2c2 for a = 2, b = 3, and c = 4.

Answers

2 • 2 • 3 • 2 • 4 • 2
multiply those and u get 192!!

Answer:

576

Step-by-step explanation:

Substitute the variables and solve.

[tex]a^2b^2c^2\\\\(2)^2(3)^2(4)^2\\\\(4)(9)(16)\\\\576[/tex]

It is given that
A = {1, 2, 3, 4, 7} and B = {2, 4, 8, 10).
(i) List all the elements in A∩B in set notation.
(ii) Draw a Venn diagram to represent the sets A and B. ​

Answers

[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]

Given :

A = {1, 2, 3, 4, 7}

B = {2, 4, 8, 10)

A∩B = {2 , 4 }

See the venn diagram in attachment ~

4. Susannah is drawing a card from a standard 52-card deck. A standard deck of cards

contains four suits -- diamond, club, spade & heart. Each suit has 13 cards. Face cards (12)

are Jack, Queen, and King cards.

a. What is the probability that the card she draws is a diamond?

b. What is the probability that the card she draws is a face card?

c. What is the probability that the card she draws is a face card and a diamond?

d. What is the probability that the card she draws is a face card or a diamond?

Answers

Answer:

1/4(25%), 3/13(23%), 3/52(6%), 11/26(42%)

Step-by-step explanation:

a. 4 suits, therefore the probability is 1/4

b. there are 12 face cards. therefore the probability is 12/52 which simplifies to 3/13

c. there are only 3 cards that are diamonds and face cards. Therefore, it is 3/52

d. there are 12 face cards and 13 cards of each suit. But there are 3 that overlap. therefore, there are 22 in total, so 22/52. it simplifies to 11/26.

6 adults & 4 senior citizens have to pay $228 while 13 adults and 7 senior citizens have to pay $459 to visit an exhibition at the Art science Museum . Find the total amount 2 adults & Senior citizen have to pay to visit the exhibition.​

Answers

Answer: Rs. 69

Step-by-step explanation:

Let the amount that the adults have to pay be Rs. “x” and the amount that the senior citizens have to pay be Rs. “y”.

Step 1:

According to the question, we get

Equation 1:

6x + 4y = 228  

Equation 2:

13x + 7y = 459  

Step 2:

Then, by multiplying equation 1 by 7 & equation 2 by 4, we get

7 * [6x + 4y = 228]

⇒ 42x + 28y = 1596 …. (iii)  

And,

4 * [13x + 7y = 459]

⇒ 52x + 28y = 1836 …. (iv)

Step 3:

Now, Subtracting eq. (iii) from eq. (iv), we get

52x + 28y = 1836

42x + 28y = 1596

(-)    (-)         (-)

---------------------------

10 x = 240

----------------------------

⇒ x = 240/10 = 24

Substituting the value of x in Eq. (1)

(6*24) + 4y = 228  

⇒ y = [228 - 144]/4 = 21

Step 4:

Thus,  

The total amount that 2 adults and a senior citizen have to pay to visit the exhibition is,

= 2x + y

= (2*24) + 21 ….. [substituting x= 24 & y = 21]

= Rs. 69

Step-by-step explanation:

Hope this helps

can i get braineist

Which is the better buy?

A 450 g box of cereal for $4.69 or a 600 g box of cereal for $6.49?

Please show ALL of your work.

hint: convert each to a unit rate using "cost / gram", then compare each to see which is cheaper.

Answers

Answer:

450g box of cereal for $4.69 is cheaper

Step-by-step explanation:

450/4.69 = 95.9488272921/1

600/6.49 = 92.4499229584/1

Please help me fast I need to finish!!!!!!

Answers

Answer:

ans: The line passes through the point (0,13)

Step-by-step explanation:

(0,13) is Y-intercept

Answer:

The answer is C the line passes through (0,13)

Step-by-step explanation:

Please explain! I need help!

Answers

Answer:

B is the correct answer.

Step-by-step explanation:

OMGGG PLS HELP ME WITH THIS QUESTION PLS PLS PLS!!! WILL MARK BRAINEST AND PLS PLS PLS DO EXPLAIN!!!

Answers

Answer:

38

Step-by-step explanation:

-(5×-7-3)

-(-35-3)

-(-38)

38

What is the slope of a line perpendicular to the line whose equation is 6x+4y=72 Fully simplify your answer.

Answers

Answer:

m = 2/3

Step-by-step explanation:

4y = -6x + 72

y = -3/2x + 18

Negative reciprocal = 2/3

A bicycle has a speed of 6 m/s. What is its speed in km/h?
(1 km=1000 m)
(1 h = 3600 s)

Answers

answer:

m/s --- km/h = [tex]\frac{1000}{3600}[/tex]

km/h= [tex]\frac{5}{18}[/tex]

6m/s= [tex]\frac{6*5}{18}[/tex]

6m/s= 1.66 km/h

The speed of the bicycle in km/h is 21.6 km/h.

Given that;

A bicycle has a speed of 6 m/s.

Since we know that;

1 km = 1000 m

And, 1 hour = 3600 s

Hence change the speed of the bicycle in km/h as;

[tex]Speed = 6 m/s[/tex]

It can be equal to;

[tex]Speed = \dfrac{6 \times \dfrac{1}{1000} km }{\dfrac{1}{3600} seconds }[/tex]

[tex]Speed = 21.6 km/s[/tex]

Therefore, the speed of the bicycle in km/h is 21.6 km/h.

To learn more about the measurement unit visit:

https://brainly.com/question/777464

#SPJ3

Abbie is twice as old as susan susan is 5 year old than Marc how old is Marc?

9
7
5
2

Answers

Answer:

9

Step-by-step explanation:

Answer:

A.) 9

Step-by-step explanation:

Can you help me please

109% of 11

Answers

Answer:

11.99

Step-by-step explanation:

The monthly cost of a certain texting plan is given by the function C(n)= 0.06n +9.95, where C(n) is in dollars and n is the

number of texts sent in a month. Find and interpret C(90)

Monthly Cost of Texting Plan

Ac(n)

Answers

Answer:

C(90) = 15.35

Step-by-step explanation:

Given the function, C(n) = 0.06n + 9.95:

where C = total cost of texting plan

n = number of texts sent in a month

9.95 = flat fee

To find C(90):

Substitute 90 as the input, n,  for the function:

C(90) = 0.06n + 9.95

C(90) = 0.06(90) + 9.95

C(90) = 5.40 + 9.95

C(90) = 15.35

C(90) represents the cost of sending 90 texts in a month is $15.35.

Please mark my answers as the Brainliest if you find my explanations and solutions helpful :)

Graph the line that goes through the points (2,0) and (2,5).

The line is what
.
The line has what
slope.

Answers

Answer:

0

Step-by-step explanation:

5 - 0 = 5

2 - 2 = 0

5/0 = 0

Answer:

Step-by-step explanation:

In the triangle, m∠JKL = 3° and m∠KJL = 17°. Find m∠JLM.

Answers

Answer:

160

Step-by-step explanation:

the middle letters ttell you which corner of the triangle has that degree.

all corners added together must equal 180 in a triangle

jkl has k in the middle so k is 3°

kjl has J in the middle so J is 17°

jlm has L in the middle and is unknown

K + J + L = 180

3+17+L = 180

20 + L = 180

L = 160

Answer:160 degrees

Step-by-step explanation:

180-3-17=160

All triangles neasure 180 degrees

find the y intercept
y = 3/4x - 4

Answers

It is 8+783 to the 2 power
the y-intercept is the point on the graph where it crosses the y-axis, and has coordinates (0, b). It is also the value of y when x = 0.

To find the y-intercept, set x = 0:

y = -3/4(0) - 4

y = 0 - 4

y = -4.

Therefore, the y-intercept is (0, -4), or -4.

-50= 6a+28 please help

Answers

-50 = 6a + 28

Subtract 28 from both sides.
-50 -28 = 6a + 28 - 28
-78 = 6a

Divide both sides by 6.
-78/6 = 6*a/6
-78/6 = a

-13 = a

Answer:

a=-13

Step-by-step explanation:

-50=6a+28

isolate the a

-50-6a=28

-6a=28+50

-6a=78

divide both sides by -6

a=-13

100 POINTS AND BRAINLIEST!!

Answers

Answer:

A.   $47,143

Step-by-step explanation:

Given information:

Current annual lifestyle cost ≈ $33,000Take home pay estimation = 70%

Gross income: Total income before any deductions.

If take home pay is approximately 70% of the annual gross income, to be able to maintain the current lifestyle, 70% of the annual gross income needs to be at least $33,000.

Let x = annual gross income

Therefore:

70% of x = $33,000

⇒ 0.7x = 33000

⇒ x = 33000 ÷ 0.7

⇒ x = 47142.8571...

Therefore, the annual gross income needs to be $47,143 (nearest dollar) to maintain the current lifestyle.

Annual gross income be y

70% of y=330000.7y=330007y=330000y=330000/7y=47143

Option A

Can someone help me do this

Answers

Answer:

x = 6

Step-by-step explanation:

because of the exterior angle theorem, instead of looking for the inner angle's amount, I can directly look for the other angle's amount.

so:

6x + 8 + 5x + 8 = 82

11x + 16 = 82

11x = 66

x = 6

find the measure of the angle.

Answers

165 degrees :) your welcome

Algebra question need it done

Answers

Answer:

y=2x

Step-by-step explanation:

Y = 2x because the y value is twice the x value in the table

What are the x- and y-intercepts of f(x)=x^2-49?

Answers

x-intercept(s):
(7,0),(−7,0)(7,0),(-7,0)
y-intercept(s):
(0,−49)

can someone with This thank you!!​

Answers

Answer:

(a)

Coordinate A: (0,-3)

Coordinate B: (1,0)

Coordinate C: (5,2)

(b)

1, 5, 6, 7

The coldest day in ohio clocked in at 40 below zero. In one day though the temperature changed to 20 below zero How much temperature change was there that day

Answers

40 below 0 would be -40 and 20 below 0 would be -20°. So there’s a change of (increase of) 20° that day. It would also make sense if you drew a number line. You would see the interval between -40 and -20 is 20.
Other Questions
Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine?