Answer:
its osmosis
Explanation:
Active transport is the energy consuming process that involves the movt of molecules from their region of low concentration to a region of high concentration.
Diffusion is the net movt of molecules or ions from a region of their higher concentration to a region of their lower concentration.
Facilitated diffusion is the transport of molecules and ions across a membrane by specific transport proteins,carriers and channel proteins found within the membrane in the direction of lower concentration down a concentration gradient.
Osmosis is the net movement of water molecules from a region of their high concentration to the region of their lower concentration through a partially permeable membrane. OR this is the passive movement of water molecules across a partially permeable membrane from a region of lower solute concentration to a region of higher solute concentration.
Answer:
ayo its me imthetarget hows it going
Explanation:
Question C. please... :) And NO FILES I WILL REPORT YOU!
describe a chemical reaction
Answer:
The chemical reactions is a process in which one or more substances, the reactants, are converted to one or more different substances, the products.
Explanation:
.
Answer:
A chemical reaction is a process in which the reactants are converted into one or more different substances. A chemical reaction occurs when certain bonds between the atoms are formed or broken. The substances that are formed at the end of the reaction are called products.
Hope this helps! :)
correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat
please help asap
Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:
Answer:
humans- exposes them to the ultra-violet rays of the sun causing cancer
animals- causes the pollution of gases found within the atmosphere
plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants
Environment- causes global warming
Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )
Answer:
Please where's the image of the question
Answer:
B
Explanation:
Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.
Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.
Somebody please help? Thanks
Answer:
None
Explanation:
because y is recessive and it needs to be yy to be green so Yy wouldn't wrok
Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose
Answer:
A
Explanation:
Help please :) thank u
Answer:
!! neither mechanical nor chemical digestion
A moon has less mass than a star and more mass than a planet it orbits.
•True
•False
is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands
Answer:
false
Explanation:
which type of specialized cells would be found in an animal’s neuvous system?
The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.
What is the nervous system?The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.
Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.
Therefore, the correct option is D. Cells that can transmit signals around the body.
To learn more about the nervous system, refer to the link:
https://brainly.com/question/29355295
#SPJ2
The question is incomplete. Your most probably complete question is given below:
Cells that transport oxygen are found in the blood.
Cells that secrete hormones to trigger cellular responses.
Cells secrete enzymes to break down food.
Cells that can transmit signals around the body.
Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?
It increases the probability that moving water will promote gene flow from one population to another.
It increases the chance of the recombination of alleles, leading to genetic drift in the population.
It increases opportunities for offspring to compete for limited resources.
It increases the probability that some offspring will survive long enough to reproduce.
Answer:
increases opportunities for offspring to compete for limited resources.
Create a food chain with a producer and 3 consumers.
Answer: dandelion is consumed by bees, grasshoppers, and butterflies.
Answer:
primary consumers, secondary consumers, tertiary consumers.
Explanation:
Hope this helps
What is the process of the digestive system?
Answer:
In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.
In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.
Please help!! Any word is greatly appreciated :) thanks <3
Stem anatomy
WORD DEFINITION
Monocot Plant where Xylem and Phloem are arranged in bundled scatters
Node Location on the stem where leaves and buds are attached
Corm A bulb-shaped specialized stem that is made of solid stem and had no leaves
Stolon Specialized stem that is usually horizontal and above the soil
Specialized Stems Bulbs, Corm, Rhizomes, and Tubers
Apical Meristem Actively growing tip found inside a terminal or lateral bud
Terminal Bud End of stem or branch
Xylem Cells in the stem where they carry UP water and minerals
Lenticel A mark on the outside of the stem that allows gas to be exchanged
Lateral Bud Bud that is found on the side of the branch
Sapwood Part of woody stem that actively conducts water and dissolved minerals
Bulb Specialized stem made of short, flat stems and contains many fleshy leaves
Dicot Plant where it's Xylem and Phloem are arranged in a circle
Inter Node Area on the stem that lies between 2 leaves/buds
Leaf Scar Scar left when a leaf falls off
Bud Scale Scar Area in the stem that shows the location of last years bud
Phloem Tube-shaped cells that carry DOWN water and minerals
Tuber Specialized stem that's tip is swollen with stored food
Rhizome A specialized stem that is thick and runs horizontally under the soil
Bud Scale Small protective structure that can be seen on the outside of a bud
Vascular Cambium Area inside stem where new Xylem and Phloem are made
Explanation:
hope this here helps you
I attached the words in order down below
true or false
Only animals have a niche.
Answer:
False
Explanation:
Answer:
True
Explanation:
In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.
A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________
B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.
C. A short winged fly can be described -using words as what?
D. What type of inheritance is this called?
Answer:
A. Normal Wings= Ww, Small Wings=ww
B. All offspring will have short wings because short wings trait is recessive.
w. w
______
w| ww |ww|
————-
w|ww |ww |
______
Explanation:
I need URGENT help with 16 through 18 pls!!!
Answer:
16. Directional Selection
17. Disruptive Selection
18. Stabilizing Selection
19. Natural Selection
20. Adaptation
Explanation:
In population genetics, directional selection/positive selection is a mode of natural selection in which an extreme phenotype is favored over other phenotypes.
Disruptive Selection would show phenotypes (individuals with groups of traits) of both extremes but have very few individuals in the middle.
Stabilizing Selection. Occurs when individuals at the extremes of the range of characteristic are selected against. This means that the "average" individuals are selected for.
The pancreas secretes enzymes and bicarbonate into the a. esophagus c. duodenum e. ileum b. stomach d. jejunum
Answer:
C. Duodenum
Explanation:
hope this helps!
the answer should be the duodenum
what is the term for the process of cell division that results in the formation of gametes ?
Answer:
meiosis
Explanation:
The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass
Answer:
A
Explanation:
The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^
Explanation:
A because im big brain
refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity
Answer:
Gender Role
Explanation:
How people already see how people should act. Example- Be a man.
Answer:
b. sex
Explanation:
edge 2021
6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.
Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?
Explanation:
Why is the success of a mutation dependent on environmental conditions?
PLEASE HELP QUICK!!!
The different forms of the beef cattle color gene are called_
The different forms of the beef cattle color gene are called "alleles"
What are alleles?Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.
In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.
The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.
Learn more about alleles, here:
https://brainly.com/question/14104138
#SPJ6
Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-
Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-
The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-
A new strain of influenza breaks out in New York City-
The population of rabbits and a population of deer are both feeding off the same plants in the same area-
Hurricane Katrina forced thousands of people to leave New Orleans-
65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.
Answer choices: Density Dependent
Density Independent
Answer:
Density Dependent
Explanation:
i think hope it helps
What does the phrase of sunshine and of song mean in the poem?
A.
memories
B.
weather
C.
happiness
D.
singing
Answer:
a
Explanation:
What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.
Answer:
.
Explanation:
Explanation: Open Photo ;)
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG