I NEED HELP LOOK AT IT WHAT IS IT?????????????

I NEED HELP LOOK AT IT WHAT IS IT?????????????

Answers

Answer 1

Answer:

B

Step-by-step explanation:

2.15 is bigger than 2.087

Answer 2

Answer:

2.087 < 2.15

Step-by-step explanation:

ok even as a decimal 2.087 is less than 2.15

2.087 < 2.15


Related Questions

hey, I need the answer asap An amusement park charges $120 for a one-week pass. If the pass is put on sale at a 25% discount, what is the amount of the sale price of the pass?

Answers

Answer:

It costs $90 dollars afterwards.

Step-by-step explanation:

Please can someone help me

Answers

The picture is very blurry for me can you take another

write the sum as the product of the GCF and another sum of 48+64

Answers

i think the answer is 112 because it’s the sum

What is the inverse of f(x)=x^4 + 7 for x>0 where function g is the inverse of function f​

Answers

The first answer

cbjsabcakvscds

The inverse function of the function f(x) will be [tex]\rm g(x) = \sqrt[4]{x - 7}, x \geq 7[/tex]. Then the correct option is A.

What is the inverse function?

Let the function f is given as

y = m(x + a) + c

Then the inverse function of the function f will be given by the swapping of x with y and y with x.

The function is given below.

f(x) = x⁴ + 7

The inverse function of f(x) will be

x = [g(x)]⁴ + 7

[g(x)]⁴ = x - 7

[tex]\rm g(x) = \sqrt[4]{x - 7}[/tex]

The function is valid for x ≥ 7.

The inverse function of the function f(x) will be [tex]\rm g(x) = \sqrt[4]{x - 7}, x \geq 7[/tex]. Then the correct option is A.

More about the inverse function is given below.

https://brainly.com/question/2541698

#SPJ2

Please I need some answers

Answers

Square root of 256 is 16
Square root of 625 is 25
Square root of 121 is 11
Square root of 256 is 16 I believe as well

What is the slope of (-2,-6) and (-7,-5)?

Answers

Answer:

   = -1/5

Step-by-step explanation:

To find the slope we use

m = ( y2-y1)/(x2-x1)

   = ( -5 - -6)/(-7 - -2)

  ( -5 +6)/(-7 +2)

    1/-5

   = -1/5

Answer:

-1/5

Step-by-step explanation:

Y2 - Y1 / X2 - X1

-6 - -5 / -2 - -7

Convert: -6 + 5 / -2 + 7

-1/5

Hope that helps!

x+2=6x-18

WHAT NUMBER IS X

Answers

Answer:

x=4

Step-by-step explanation:

hope this helps!

Answer: x=4




Explanation

what is 5*5+100-99*76

Answers

Answer:

-7399

Step-by-step explanation:

mark me brainiest please

Answer:

-7399

Step-by-step explanation:

5*5+100-99*76

25 + 100 - 7524

= -7399

PLZ HELP!
in a survey, 25 out of 200 students are planning to vote for Susie for class president. If there are 1,000 students voting, how many votes would Susie expect?

Answers

Answer:

125 votes

Step-by-step explanation:

Set up a proportion.

[tex]\frac{25}{200} =\frac{x}{1000}[/tex]

Cross-multiply.  Solve for x.

[tex]25,000=200x\\25,000/200 = 200x/200\\125=x[/tex]

Susie can expect 125 votes.

what is 3298.96907216 to the nearest thousand

Answers

Answer:

3298.96907216 is nearest to 3000

Plz help! Is this right? Question is below!

Answers

Answer:

500m

Step-by-step explanation:

This question is really asking for the perimeter of the rectangle. The two of the longest sides is 14 units, the other 2 are 11 units. 14 + 14 + 11 + 11 = 50 units/ 1 unit is 10m, so 50 by 10 is 500, 500 meters.

Find the value of X. Then find the measure of each labeled angle.​

Answers

Answer:

x=118, top right angle is 118, bottom right is 62, bottom left is 90, and top left is 90

Step-by-step explanation:

1. since a quadrilateral's andles sum up to 360, these must sum up to 360

2. since the two sides (top and bottom) are parallel, the bottom left and top left angles add up to 180 (it's a conjecture)

3. this means that (x-56) + x+ 90 + (180-90)=360

4. simplify: 2x + 124 = 360

5. solve: x= 118

6. this means top right angle is 118, bottom right is 62, bottom left is 90, and top left is 180-90=90

What is the slope of a line that is perpendicular to the
line shown on the graph?

Answers

Answer:

D or four

Step-by-step explanation:

The slope of a perpendicular line is always the reciprocal of the first lines slope :) have a nice day!

slope of (-7,8) (-7,5)

Answers

answer is undefined


Why can you use Linear Pairs and Vertical Angles to prove lines are parallel?

Answers

Answer:

The reason why linear pairs and vertical angles are used to prove lines are parallel is because they area transversal drawn through the parallel lines will form angles on each of the two parallel lines including;

1) Supplementary linear pairs  and

2) Vertical angles

3) Alternate angles

Given that either;

a) The corresponding angles that form the linear pairs are congruent

b) The corresponding vertically opposite angles are congruent

c) The corresponding alternate angles are congruent, we have;

The two lines are said to be parallel.

Step-by-step explanation:

Jerry is taking care of a vacant lot in his neighborhood. There are approximately 64 thistle weeds m the local

He decided to try a homemade weed killer his grandmother suggested. Five weeks later, the thistles have

decreased by 75%. Approximately how many thistles are in the vacant lot now?

Answers

Answer:

16

Step-by-step explanation:

To be able to find the number of thistles that are in the vacant lot now using the information provided, you have to calculate the 75% of 64 and then, subtract that number from 64:

64*0.75=48

64-48=16

According to this, the answer is that there are 16 thistles in the vacant lot now.

बच्चे को पाला
please figure this out i cannot translate from hindi so please use google

Answers

Answer:

Nursed baby

Step-by-step explanation:

Given the function:
f (x) = (3 x + 4) minus (2 minus x)
Evaluate for f (5).
a.22
b.15
c.16
d.30

Answers

f(5) = [3(5)+4] - [2-(5)]

f(5) = (15+4)- (-3)

f(5) = 19+3

f(5) = 22

Answer:

A

Step-by-step explanation:

What is linear equation​

Answers

Answer:

An equation that makes a straight line when it is graphed. Often written in the form y = mx+b. Equation of a Straight Line

Step-by-step explanation:

I don’t know what this is or have any idea how to do it can someone help and explain

Answers

Answer:

w = -13

Step-by-step explanation:

Since BC bisects <ACD, then <ACB = <BCD.

We know that those two angles must equal 108 because 180-72=108.

Half of 108 is 54.

<BCD is the same as the same as the angle that equals 2w+80, so

2w+80=54

2w=54-80

2w=-26

w=-13

Please, this is due tomorrow!!! Boyle's Law in chemistry states that when the temperature is constant, the pressure of a gas is inversely proportional to its volume. Let p represent the pressure, and let V represent the volume of the gas. At a certain temperature, V = constant/p. By what factor does the volume of the gas change if the pressure changes by each given factor?
a. 2
b. 3
c. 4
d. 5

Answers

Cuñada mela uva dulula

2) Eight is 5 less than
twice the number R.

Answers

Answer:

8-5 times R

Step-by-step explanation:

you subtract 8-5 to get that answer and then you do less than twice the number r i think this is correct hope it helps :)

1.) The following figures are congruent. What side corresponds to side CD?

a. Side WX
b. Side ZX
C. Side YZ
d. Side WY

Answers

Answer:

C Side ZX

Because ZX is a reflection of CD

George’s age is three times that of his brother. When you add George’s age to his brother’s, you get 24. How old is each brother?
a) Write an equation that represents the situation. Explain any variable used.
b) Solve the equation from Part (a). Show your work. State your solution as a complete sentence.

Answers

Answer:

G=18

Step-by-step explanation:

George-G

1/3G+G=24

4/3G=24

3/4*4/3G=24*3/4

G=18

George will be 18 years old there we can find his brothers age by dividing it by three thus 18/3=6

Answer:

George is 18 and his brother is 6

Step-by-step explanation:

let the brother's age be n then George's age is 3n ( 3 times his brother's age )

n + 3n = 24 ( sum of their ages )

4n = 24 ( divide both sides by 4 )

n = 6

and 3n = 3 × 6 = 18

George is 18 years old and his brother is 6 years old.

2(7-3)+4(10÷2) use the oder of operations to simplify ​

Answers

Answer:

the answer is 28

Step-by-step explanation:

2×4+4+5

8+20

28

Elmer had $125.35 saved up. He wanted to buy a surf board that costs $400. On his way to work to saw some snorkel gear and bought it for $59.99. Now how much money does he need to save in order to buy the surf board? *

Answers

Answer:

334.64

Step-by-step explanation:

Convert to Slope-Intercept Form to graph 4x+3y=9

Please show the two points

Answers

4x+3y=9
-4x -4x
——————
3y= -4x+9
/3 /3
——————
y=-4/3x+3

The line of the equation in the Slope-Intercept Form would be; y=-4/3x+3

How to get the slope-intercept form of a straight-line equation?

If the slope of a line is m and the y-intercept is c, then the equation of that straight line is given as y = MX +c. To find the slope of a line, the rate at which the value of 'y' is increasing as we increase the value of 'x' by one unit.

Given that 4x+3y=9

Thus, 4x+3y=9

Subtract 4x on both sides;

4x -4x + 3y = 9 -4x

Now divide by 3 on both sides

3y= -4x+9

Then we get;

y=-4/3x+3

Hence, the line of the equation in the Slope-Intercept Form would be; y=-4/3x+3

Learn more about slope here:

brainly.com/question/2503591

#SPJ2

A car has a 16-gallon fuel tank. When driven on a highway, it has a gas mileage of 30 miles per gallon. The gas mileage (also called "fuel efficiency") tells us the number of miles the car can travel for a particular amount of fuel (one gallon of gasoline, in this case). After filling the gas
tank, the driver got on a highway and drove for a while.How many miles has the car traveled if it has 10 gallons of gas left in the tank?
and write an equation that represents the relationship between the distance the car has traveled in mikes, d, and the amount of gas left in the tank in gallons, x

Answers

Answer:d=(16-x)30

Step-by-step explanation:

The car traveled 600 miles if it has 10 gallons of gas left in the tank.

What is the equation?

The equation is defined as mathematical statements that have a minimum of two terms containing variables or numbers that is equal.

To determine the equation that represents the relationship between the distance traveled by car and the amount of gas left in the tank.

Let the distance traveled by car would be d miles,

and the amount of gas left in the tank would be x gallons

Since the car had a 16-gallon fuel tank

So the amount of gas left in the tank would be 16 - x

When driven on a highway, it has a gas mileage of 30 miles per gallon.

To find the equation of the distance we have to calculate the product of gas left in the car and the mileage of the car.

So the required equation as:

⇒ d = (16-x)30.

If it has 10 gallons of gas left in the tank

Substitute x = 10 in the above equation, we get

⇒ d = (16-10)30.

⇒ d = (20)30.

⇒ d = 600.

Therefore, the car traveled 600 miles if it has 10 gallons of gas left in the tank.

Learn more about the equation here:

brainly.com/question/10413253

#SPJ2

hey y'all I need help writing this as a slope I so lazy​

Answers

Answer:

1/2 that is the right answer

If 8 miles denotes 8 miles due north what denotes 5 miles due south

Answers

Answer:

15

Step-by-step explanation:well, if 8x^8 goes north, and 5 miles south the answer would be 15 because 8x^8 N and 5 miles S using the phemols, it would be 15.

Other Questions
By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4)