If you are unsure about whether or not to include a citation because you have seen that information somewhere before, a. It means the information is not important enough to cite c. You should consider it common knowledge b. You should include a citation anyway d. You should leave it out of your paper Please select the best answer from the choices provided A B C D

Answers

Answer 1
The answer is:
B. You should include a citation anyway.
Hope this helps :)
Answer 2

Answer: B. You should include a citation anyway

Explanation: I just did it on edge 2023. Hope this helps!


Related Questions

One of the legs of a right triangle measures 2 cm and its hypotenuse measures 9 cm. Find the measure of the other leg. If necessary, round to the nearest tenth.

Answers

Answer:

The measure of the other leg = 8.8 cm

Explanation:

Given - One of the legs of a right triangle measures 2 cm and its hypotenuse measures 9 cm.

To find - Find the measure of the other leg.

Proof -

We know that,

For a right angle triangle,

Apply The Pythagoras Theorem , which states that

(Hypotenuse)² = (Base)² + (Perpendicular)²

Given that,

Hypotenuse =  9 cm

One leg = 2 cm

Let us assume that,

One leg is base and another leg is Perpendicular.

We also can suppose vice-verse, it does not affect the solution.

Now,

(Hypotenuse)² = (Base)² + (Perpendicular)²

⇒(9)² = (2)² + (Perpendicular)²

⇒81 = 4 + (Perpendicular)²

⇒81 - 4 = (Perpendicular)²

⇒77 = (Perpendicular)²

⇒√77 = Perpendicular

⇒Perpendicular = 8.775 ≈ 8.8

∴ we get

The measure of the other leg = 8.8 cm

1 ).Which religion celebrates christmas easter and pentecost?
A) christianity
B) judaism
C)hinduism
D)islam

2). belief in a set of principles that guide ones life is
A)ethiclism
B) animism
C). polytheism
D). monotheism

Answers

Answer:

Q1

A) Christianity

Q2

A) Ethiclism

which force is correctly matched relative to its type of fault?

Answers

1. normal fault This fault can create features like scarps, horsts and grabens, and fault-block mountains. compressional stress 2. reverse fault tensional stress This fault is where two rock blocks can grind past each other in a parallel direction. 3. strike-slip fault shear stress This fault occurs when a hanging wall block has risen relative to its footwall block.
Other wise I don’t know what your asking

A scientist is studying the average speed and fastest recorded speed of four creatures. His results, in miles per hour, are shown in the table below.

For which creature is the difference between average speed and fastest speed the greatest?


Werewolf
Phoenix
Mermaid
Centaur
They are all the same.

Answers

where are the results?

What's the answer the number

Answers

Answer:

Show the picture

Explanation:

a is a short document that briefly outlines qualifications abillities and accomplishments

Answers

Answer:

Curriculum vitae (resume).

Explanation:

Certification can be defined as a recognition given for completing a course of study or passing an examination. This is to certify that the individual is a professional in that course of study. Some examples are CCNA, Comptia A+, HSE I and II, degree certificates, etc.

A Bachelor's degree refers to an academic degree (certificate) awarded to a student by a tertiary institution (university or college) after the completion of his or her educational programme. Bachelor's degree is generally being referred to as first degree because it is the first certification to be acquired by an undergraduate student after the completion of his or her course of study. Mostly, a bachelor’s degree program lasts for four (4) years and in some cases it is typically for five (5) years.

The second (next) degree a graduate obtains after the acquisition of a first degree (bachelor degree) is the master's degree. The advantage of a master degree is that, it can be obtained in a different academic field such as science, engineering, education etc.

A curriculum vitae (resume) is a short document that briefly outlines qualifications, abillities and accomplishments of a person, haven completed and obtained an academic certificate.

Generally, all job applicants are required to have a curriculum vitae (resume). This document is always requested by human resource managers during the job application process. Thus, all applicants must attach it to their written application letter because it's a profile summary of the necessary information needed for a particular job.

Can someone Plz give me skin in fornite I'm poor and I have no battle pass no v bucks like 0 and I just want one plz my user is Emily_mari90 again Emily_mari90

Answers

Answer: Fort nite sorry when i think of fort nite i think reekid lol

Explanation:

Add
Thave a recipe for cheese quesdillas that makes 5
servings. I want to make enough for 90 servings.
What is the conversion factor? Write the division
problem and its solution.

Answers

Answer:

It takes 18 times the ingredients in the recipe to make 18 servings.

Explanation:

Since I have a recipe for cheese quesdillas that makes 5 servings, and I want to make enough for 90 servings, to determine what is the conversion factor that will determine how many times the ingredients of the recipe are needed, the following calculation must be performed:

90/5 = 18

Therefore, it takes 18 times the ingredients in the recipe to make 18 servings.

The hardest question ever. in SatMath. please help me

Answers

Answer:

750

Explanation:

I'm gonna make my best effort here... (it's been a long hecking time since SAT math last year :P)

Set both equation equal:

5x = -15x + 3000

20x = 3000

x = 150

Plug into any equation because both are equal anyway:

y = 5x

y = 5(150)

y = 750

(a, b) --> (x, y)

The point is (150, 750) and b = 750

Which cell type is produced from meiosis? haploid diploid prokaryotic somatic

Answers

Meiosis produces cells that are 1N. Another word for this is haploid.

The cell type of the daughter cell in the meiosis is haploid. Hence, option A is correct.

What is meiosis?

Meiosis is given as the type of cell division that gives rise to the new daughter cell. It is the reduction division cycle that takes place in the cell, with the formation of four daughter cells.

The meiotic division forms the development of the daughter cells with the division of the chromosome sets. It is termed as reduction division as the number of chromosomes reduced to half in the daughter cells.

Thus, the cell type of the daughter cell in the meiosis is haploid. Hence, option A is correct.

Learn more about  meiosis, here:

https://brainly.com/question/10621150

#SPJ2

Although, as boys, we had been even intimate associates, yet I really knew very little of my friend. His reserve had been always excessive and habitual. What does this excerpt reveal about the narrator of the story? It describes what the narrator knows from his past. It describes what the narrator experiences in the story. It provides an inference drawn by the narrator. It provides a criticism voiced by the narrator.

Answers

We required to explain what the excerpt reveal about the narrator of the story.

The excerpt "provides a criticism voiced by the narrator".

From the excerpt, it provides a criticism voiced by the narrator. The narrator is voicing out the criticisms about his friend. Even though he has been together with his friend for a long time yet he knows little about his friend because his friend is reserved.

His friend is described as someone who is too reserved and as such speaks little about himself. This is seen as an habits of his friend.

Therefore, the excerpt "provides a criticism voiced by the narrator".

Read more:

https://brainly.com/question/21400963

Answer:

It describes what the narrator knows from his past

Explanation: trust me

Fun Fact


Frogs buttholes are water tight

Answers

Answer:

amazing!

Explanation:

i need the answer ASAP

Answers

Answer:

chromosomes is the answer.

1 point

Explain why the land heats and cools this way.

Answers

I’m going to assume your talking about wind currents and stuff like that right?

i need help w/ this. Ty

Answers

I’m pretty sure it’s
The Sahara Desert is a natural resource that stretches across Africa in an area that is almost as big as the United States.
:)

Answer:

i think its resource

Explanation:

i THINK

which skills are most likely to start at birth and develop as a person matures

Answers

Answer:

facial recognition

Explanation:

babies at birth cant remember faces, that's why when a face disappears they get surprised when it comes back.

how much total energy is containted in a single serving of this cereal with a 1/2 cup of fat free milk?

Answers

Answer:

190 calories

Explanation:

Hope this helps

Which expression is equivalent to 6x-9/3​

Answers

Answer:-18

Explanation:

Answer:

its b

Explanation:

i took the quiz

A confounding variable can also be considered an extraneous variable. Please select the best answer from the choices provided T F

Answers

Answer: true

Explanation:

1.Assinale a oração em que o termo destacado seja um adjetivo: *

Mas que pernas ! Nunca tinha
reparado na feiura das minhas pernas.

b) “[...] uma alcateia de ferozes foi chegando e espalhou o bando, que correu assustado.”.

c) “O alce para a mata e perdeu-se do bando.”.

d) “No caminho, o chifre numa árvore e quase foi devorado pelo lobo.”.

Answers

It’s gone b b because there is no other reason

Which statement represents the key difference between the Court’s view of equal access in Plessy and its view in Regents? The Court shifted from opposing legal segregation to supporting it. The Court shifted from saying that segregation was legal to saying that any laws made based on race would be subject to careful judicial scrutiny. The Court shifted from arguing that African Americans were entitled to legal protection to arguing that they were not. The Court shifted from actively discouraging racial segregation to actively encouraging it.

Answers

Answer:

The answer is B "The Court shifted from saying that segregation was legal to saying that any laws made based on race would be subject to careful judicial scrutiny."

Explanation:

Taking the assignment right now and got it right.

The statement that represents the key difference between the Court’s view is the Court shifted from saying that segregation was legal to say that any laws made based on race would be subject to careful judicial scrutiny. The correct option is b.

What is a court?

Plessy v. Ferguson was a landmark 1896 Supreme Court decision that upheld the legality of racial segregation under the "separate but equal" principle. The case began in 1892, when African-American railroad traveler Homer Plessy refused to ride in a vehicle reserved for blacks.

The Supreme Court rejected Plessy's claim that his protected rights were violated, ruling that legislation that "implies only a juridical disparity" between whites and blacks was not unlawful. As a result, Jim Crow laws and segregated open lodging based on race became popular.

Therefore, the correct option is b.

To learn more about the court, refer to the below link:

https://brainly.com/question/4176750

#SPJ5

Choose the best Spanish word to complete the sentence. La señora Paredes ____________la casa de Manuel. visitan visita visitamos visitas

Answers

visita is the answer because the others are wrong

Answer:

visita

Explanation:

In economics, products are classified into which two categories?

Answers

Answer:

consumer products and industrial products

Answer: Classification of Products – 2 Important Categories: Consumer Products and Industrial Products. ADVERTISEMENTS: Broadly speaking, products are divided into two categories – consumer and industrial products.

Since slope is calculated using the formula m = StartFraction v 2 minus v 1 Over x 2 minus x 1 EndFraction, the slope of both lines is equivalent to ________. It is given that the lines are parallel, and we calculated that the slopes are the same. Therefore, parallel lines have the same slopes. StartFraction v minus z Over w minus x EndFraction StartFraction w minus x Over v minus Z EndFraction StartFraction v minus z b Over x minus z a EndFraction StartFraction w minus x a Over v minus z b EndFraction

Answers

Answer:

Being equivelent gives them paralell lines on a graph.

Explanation:

They cross the same slope

uhh i want a number three/baconator from wendys and fries please[tex]despasito[/tex]

Answers

Answer:

SAME Im so freaking hungry rn i feel you on that

Explanation:

Question :
what are dreams?​

Answers

Answer:

although scientist aren't exactly sure why we dream, most believe that dreaming is the brains way of keeping it entertained while we sleep

Answer: What your mind thinks/processes of the thoughts your thinking and/or have thought of.

Explanation:

Match the quotes with the literary devices they use. "O miserable abundance, O beggarly riches!" – John Donne "What a pity that youth must be wasted on the young." – George Bernard Shaw "I can resist anything but temptation." – Oscar Wilde "How is it possible to have a civil war?" – George Carlin

Answers

Matching the quotes with the literary devices they use will be:

"O miserable abundance, O beggarly riches!" – John Donne

Oxymoron

"What a pity that youth must be wasted on the young." – George Bernard Shaw

Paradox

I can resist anything but temptation." – Oscar Wilde

Paradox

"How is it possible to have a civil war?" – George Carlin

Rhetorical question

Literary devices are those things which a writer or author uses to emphasize his point or to give added spice to his written work.

These devices are useful when trying to:

Create dramatic effectMake an emphasisShow magnitude of a situation, etc.

Read more here:

https://brainly.com/question/6698661

Answer: OXYMORON-

"O miserable abundance, O beggarly riches!" – John Donne 

"How is it possible to have a civil war?" – George Carlin

PARADOX-

 "I can resist anything but temptation." – Oscar Wilde

"What a pity that youth must be wasted on the young." – George Bernard Shaw

Explanation:

Someone please help... Its due soon! D:

Answers

Answer:

A virus is a non living bacteria part of your body that causes lots of effects and sicknesses. This causes a lot of diseases.

Chicken pox for example, a highly contagious disease caused by the initial infection.

Bacteria is a living particle inside your body that runs through. This also causes diseases as well but not only that, they make you dirty and disgusting. For example Cholera, it gives you low heart rate and tired muscles and more effects on your body and in.

It is a type of medicine used for destroying micro organisms. Too much ant biotics can lead you to be sick, too much of what you need is very bad.

DNA can identify what and how microbes work and what they are.

Microbes are useful by processing and preserving food, and this causes the production of biomolecules.

How are selective breeding, genetic engineering, and natural selection alike?

Answers

Answer:

tbd

Explanation:

what are the options?

When Billy's asked how old he is, he replies, "In two years i will be twice as old as i was 5 years ago." How old is he?

Answers

12 years old using the following work

12 years old.

• Let the present age of Billy be represented by x.

• In two years, Billy will be: = x + 2

• Since in 2 years, he will be twice as old as he was 5 years ago, this will be:

x + 2 = 2(x - 5)

The equation to solve the question is:

x + 2 = 2(x - 5)

x + 2 = 2x- 10

Collect like terms

2x - x = 2 + 10

x = 12

• Billy is 12 years old.

Other Questions
Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio