I’m confused math has never really been my strong suit

Im Confused Math Has Never Really Been My Strong Suit

Answers

Answer 1

Thus, 25.13 cubic inches is the closest estimate for the ice cream's overall volume.

what is volume ?

Volume is a mathematical concept that describes how much space a three-dimensional object occupies. It is frequently expressed in terms of cubic units like cubic metres (m3), cubic feet (ft3), or cubic centimetres (cm3). Depending on the shape of the object, different formulas can be used to determine its volume. Consider this: The formula V = l w h, where l has been the length, w is the broad, and h corresponds to the height of the rectangular prism (box), gives the volume of the object. A sphere's volume can be calculated using the method V = (4/3)r3, where r is the sphere's radius.

given

The formula for a cone's volume is as follows, assuming that the ice cream has the correct circular cone shape with radius r = 2 in and height h = 6 in:

[tex]V = (1/3) * \pi * r^2 * h[/tex]

Inputting the values provided yields:

[tex]V = (1/3) * \pi * (2 in) * (2 in) * (6 in)[/tex] = 25.13 cubic inches

Thus, 25.13 cubic inches is the closest estimate for the ice cream's overall volume.

To know more about volume visit :-

https://brainly.com/question/1578538

#SPJ1

The complete question is:-  

r = 2 in.

h = 6 in.

Which is closest to the total volume of the ice

cream?


Related Questions

A 40 -degree angle is translated 5 inches along a vector. What is the angle measurement, in degrees, of the image?

Answers

The angle measurement would remain as 40 degrees

Does angle change when translated?

No, when a geometric figure, such as a line or an angle, is translated (moved) to a new position without being rotated, reflected, or scaled, its shape and size do not change, and therefore its angle measure remains the same.

This property is a fundamental concept in geometry and is known as the "invariance of angle measure under translation". It means that if two angles are congruent (have the same measure) in their original position, they will remain congruent after being translated to a new position.

Hence The angle measurement would remain as 40 degrees

Read more on translation in mathematics here:https://brainly.com/question/1046778

#SPJ1

Find the value of x such that the data set has the given mean.

102​, 120​, 103​, 112​, 110​, ​x; mean 108

Answers

The value of x in the data set is 101.

How to find mean?

The mean of a data set is the sum of all the data divided by the count n.

Therefore, let's find the mean of the data set as follows:

The mean is  the sum of the data divided by the total number of data.

Hence, let's find the value of x using the mean

108  = 102 + 120 + 103 + 112 + 110 + x  / 6

108 = 547 + x / 6

Cross multiply

108 × 6 = 547 + x

648 = 547 + x

x = 648 - 547

x = 101

Learn more on mean here: https://brainly.com/question/15925218

#SPJ1

If there are 30 people in a classroom, what is the probability that at least two have the same birthday

Answers

The probability that at least two people in a group of 30 have the same birthday is about 0.7063 or 70.63%.

To calculate the probability that at least two people in a group of 30 have the same birthday, we can use the complement rule:

P(at least 2 people have the same birthday) = 1 - P(all people have different birthdays)

The probability that the first person has a unique birthday is 1 (since there are no other people to share with yet).

The probability that the second person also has a unique birthday is 364/365 (since there are now 364 days left out of 365 that they could have a different birthday from the first person).

Similarly, the probability that the third person has a unique birthday is 363/365, and so on. So, we can write:

P(all people have different birthdays) = 1 x 364/365 x 363/365 x ... x 336/365

Using a calculator or computer program, we can evaluate this expression to be approximately 0.2937.

Therefore,

P(at least 2 people have the same birthday) = 1 - 0.2937 = 0.7063

So the probability that at least two people in a group of 30 have the same birthday is about 0.7063 or 70.63%.

To know more about probability refer here:

https://brainly.com/question/30034780

#SPJ11

Breck has 22 dimes and nickels. The total value of the coins is $1. 45. How many dimes and how many nickels does Breck have?

Answers

Let x be the number of dimes and y be the number of nickels that Breck has. We know that he has 22 coins in total so

x + y = 22

We also know that the total value of the coins is $1.45, which is equivalent to 145 cents. Since dimes are worth 10 cents and nickels are worth 5 cents, we can write another equation:

10x + 5y = 145

We can simplify this equation by dividing both sides by 5:

2x + y = 29

Now we have two equations:

x + y = 22
2x + y = 29

We can solve for y by subtracting the first equation from the second equation:

2x + y - (x + y) = 29 - 22
x = 7

Now that we know x, we can substitute it back into either equation to solve for y:

x + y = 22
7 + y = 22
y = 15

Therefore, Breck has 7 dimes and 15 nickels.

is this a linear function

Answers

no enough info to provide answer.

What is 2/3 ÷ 1/6?
A: 4/6
B: 1/6
C: 3/6
D: 5/6

Answers

Answer:

4

Step-by-step explanation:

2/3 / 1/6

= 2/3 * 6/1

= 12/3

= 4.

A recipe for banana pudding calls for 2/3 of a cup of sugar for the flour mixture and 1/4 of a cup of sugar for the meringue topping. How many cups of sugar in all is required to make the banana pudding?

Answers

Answer: To find the total amount of sugar required to make the banana pudding, we need to add the amount of sugar needed for the flour mixture to the amount of sugar needed for the meringue topping.

The recipe calls for 2/3 of a cup of sugar for the flour mixture and 1/4 of a cup of sugar for the meringue topping. To add these two fractions, we need to find a common denominator. The least common multiple of 3 and 4 is 12, so we can convert these fractions to twelfths:

2/3 = 8/12

1/4 = 3/12

Now we can add these two fractions:

8/12 + 3/12 = 11/12

So the total amount of sugar required to make the banana pudding is 11/12 of a cup.

Consider the governing equation of a system. The coefficient 'a' in the equattion is a positive constant.First, let a=4. What is the value of x in steady state? Suppose that coefficient has changed to a=2. What is the new value of x in the steady state?

Answers

To answer this question, we need to know the specific governing equation of the system. Without this information, we cannot determine the value of x in steady state for either case.

However, we do know that the coefficient 'a' in the equation is a positive constant. When a=4, we can solve for x in steady state using the given equation and the value of a=4. When a=2, we can solve for x in steady state using the same equation and the new value of a=2.

In general, the value of x in steady state will depend on the specific equation and the values of its coefficients.
Hi there! To help you with your question, I need more information about the governing equation of the system. Please provide the complete equation with 'x' and the coefficient 'a'. Once I have that information, I can help you find the steady-state values of x for a=4 and a=2.

To know more about Value click here .

brainly.com/question/30145972

#SPJ11

FILL IN THE BLANK. Use part I of the Fundamental Theorem of Calculus to find the derivative of f(x) = x∫4 1/1+4t⁴ dt f'(x)=________

Answers

The derivative of f(x) is: f'(x) = [tan⁻¹(2)/2] - [tan⁻¹(1/2)/2]

The Fundamental Theorem of Calculus is a pair of theorems that link the concept of differentiation and integration. It states that if a function f(x) is continuous on an interval [a, b] and F(x) is the antiderivative of f(x) on the same interval, then:

Part I: The derivative of the integral of f(x) from a to x is equal to f(x):

d/dx ∫a to x[tex]f(t) dt = f(x)[/tex]

Part II: The integral of the derivative of a function f(x) on an interval [a, b] is equal to the difference between the values of the function at the endpoints of the interval:

∫a to b [tex]f'(x) dx = f(b) - f(a)[/tex]

Using Part I of the Fundamental Theorem of Calculus, we have:

f(x) = x∫4 1/(1+4t⁴) dt

Then, by the Chain Rule, we have:

f'(x) = d/dx [x∫4 1/(1+4t⁴) dt] = ∫4 d/dx [x(1/(1+4t⁴))] dt

= ∫4 (1/(1+4t⁴)) dt

= [tan⁻¹(2t)/2]₄¹

= [tan⁻¹(2)/2] - [tan⁻¹(1/2)/2]

Therefore, the derivative of f(x) is:

f'(x) = [tan⁻¹(2)/2] - [tan⁻¹(1/2)/2]

To learn more about derivative visit: https://brainly.com/question/30365299

#SPJ11

Section 15 8: Problem 3 Previous Problem Problem List Next Problem 3 (1 point) Find the maximum value of f(x, y) = xºy® for x, y > 0 on the unit circle. = fmax

Answers

The maximum value of f(x, y) = x^y on the unit circle can be found using the constraint x^2 + y^2 = 1, which defines the unit circle. To solve this, we can use the method of Lagrange multipliers.

Let g(x, y) = x^2 + y^2 - 1. Then, the gradient of f(x, y) and the gradient of g(x, y) should be proportional:
∇f(x, y) = λ∇g(x, y)

Calculating the gradients:
∇f(x, y) = (yx^(y-1), x^y * ln(x))
∇g(x, y) = (2x, 2y)

Equating the components and dividing the equations, we get:
y * x^(y-1) / 2x = x^y * ln(x) / 2y

Simplifying, we obtain:
ln(x) = y

Now, using the constraint x^2 + y^2 = 1, we can substitute y with ln(x) and solve for x:
x^2 + (ln(x))^2 = 1

Numerically solving this equation, we get x ≈ 0.90097 and y ≈ ln(0.90097) ≈ -0.10536. Since we are only interested in positive values of x and y, this is the only solution in our domain. Now, we can find the maximum value of f(x, y):
f_max = f(0.90097, -0.10536) ≈ 0.79307

So the maximum value of f(x, y) on the unit circle is approximately 0.79307.

Learn more about maximum value, here:

brainly.com/question/24866444

#SPJ11

Find the 2 consecutive integers whose squares have a difference of 259

Answers

Answer:

The integers are 129 and 130.

Step-by-step explanation:

[tex] {(x + 1)}^{2} - {x}^{2} = 259[/tex]

[tex] {x}^{2} + 2x + 1 - {x}^{2} = 259[/tex]

[tex]2x + 1 = 259[/tex]

[tex]2x = 258[/tex]

[tex]x = 129[/tex]

[tex]x + 1 = 130[/tex]

The two consecutive integers whose squares have a difference of 259 are 8 and 9.

Let x be the first of the two consecutive integers, then the next integer would be x+1. We are given that the squares of these two integers have a difference of 259, so we can write an equation as (x+1)^2 - x^2 = 259. Expanding the equation gives x^2 + 2x + 1 - x^2 = 259.

Simplifying the equation gives 2x + 1 = 259. Subtracting 1 from both sides gives 2x = 258, which means x = 129. Therefore, the two consecutive integers are 129 and 130. However, we need to check if their squares have a difference of 259. We find that 130^2 - 129^2 = 169 + 260 = 429, which is not equal to 259.

Therefore, the assumption that x is 129 is incorrect. Instead, we try x = 8. Then, the next integer is 9, and their squares are 64 and 81 respectively. The difference between their squares is 81 - 64 = 17, which is not equal to 259. However, if we reverse the order, we get 81 - 64 = 259. Therefore, the answer is 8 and 9.

For more questions like Integer click the link below:

https://brainly.com/question/490943

#SPJ11

Al has a cylindrical storage container 30 centimeters tall with a diameter of 22 centimeters. How much bird food in cubic centimeters will fit in the container? Use the formula V = Bh and approximate π using 3.14. Round your answer to the nearest tenth.

Answers

The amount of  bird food in cubic centimeters will fit in the container is

11, 398. 2 cubic centimeters

How to determine the volume

The formula that is used for calculating the volume of a cylinder is expressed with the equation;

V = π(d/2)²h

Such that the parameters of the given equation are;

V is the volume of the cylinder.d is the diameter of the cylinderh is the height of the cylinder

Now, substitute the values into the formula, we have;

Volume = 3.14 (22/2)² 30

divide the values

Volume = 3.14(121)30

Now, multiply the values and expand the bracket

Volume = 11, 398. 2 cubic centimeters

Learn about cylinders at: https://brainly.com/question/9554871

#SPJ1

Qiang wants to style a 3ft x 3ft entryway. estimate to determine which style of tile will be the least expensive for this project. EXPLAIN.

Answers

The style that will be least expensive for the project, based on the product of the fractions representing the dimensions is the Style D that will yield a total cost of $25.92

What are fractions?

A fraction is a representation of a part of a whole. It is a quantity which forms part of a whole number.

The area Qiang wants to tile = 3 ft × 3 ft

The price list and area of each tile, based on the product of the fractions of the tile dimensions are;

A; (5/6) × (1 1/12) = 65/72 cost 3.25

B; (5/6) × (2 1/12) = 125/72 cost 6.20

C; (5/6) × (5/6) = 5/16 cost  2.75

D; (5/12) × (3/4) = 5/16 cost 0.90

E; (5/12) × (5/12) = 25/144 cost 0.65

The areas of the tiles are;

The number of tiles required,  are;

Cost of tiles style A = 9/(65/72) × 3.25 = 32.4

Cost of tiles style B = 9/(125/72) × 6.20 = 32.14

Cost of tiles style C = 9/(5/16) × 2.75 = 79.2

Cost of tiles style D = 9/(5/16) × 0.90 = 25.92

Cost of tiles style E = 9/(25/144) × 0.65 = 33.696

The least expensive style for the project is style D

Learn more on fractions here: https://brainly.com/question/29565692

#SPJ1

Jenelle draws one from a standard deck of 52 cards. Determine the probability of drawing either a two or a ten? Write your answer as a reduced fraction. Answer= Determine the probability of drawing either a two or a club? Write your answer as a reduced fraction. Answer=

Answers

The probability of drawing either a two or a ten is (4+4)/52, which simplifies to 2/13.
The probability of drawing either a two or a club is (3+13)/52, which simplifies to 4/13.


For the first question: In a standard deck of 52 cards, there are four 2s and four 10s. The probability of drawing either a two or a ten is the number of successful outcomes (drawing a 2 or a 10) divided by the total number of possible outcomes (52 cards). So, the probability is (4+4)/52 = 8/52. This can be reduced to the fraction 2/13.

For the second question: There are four 2s and thirteen clubs in a standard deck of 52 cards. Since one of the 2s is a club, there are three additional 2s that are not clubs. The probability of drawing either a two or a club is the number of successful outcomes (3 additional 2s + 13 clubs) divided by the total number of possible outcomes (52 cards). So, the probability is (3+13)/52 = 16/52. This can be reduced to the fraction 4/13.

Therefore,
1) Probability of drawing either a two or a ten: 2/13
2) Probability of drawing either a two or a club: 4/13

For more such questions on Probability.

https://brainly.com/question/30053671#

#SPJ11

Please help this is for a test and i need a good grade lollll

"the wind force f on a sail varies jointly as the area al of the sall and the square of the wind speed w.
the force on a sail with area an area of 500 p? is 64.8 pounds when the wind speed is 18 mph. what
would be the force for a sail with an area of 250 f12 with a wind speed of 35 mph"

please show step by step work tysmmmm <3

Answers

The force on a sail with an area of 250 f12 and a wind speed of 35 mph would be 108.72 pounds.

How to find force on sail?

We are given that the wind force F on a sail varies jointly as the area A and the square of the wind speed W. We can represent this relationship mathematically using the equation:

F = k * A * W²

where k is a constant of proportionality.

We are also given that the force on a sail with an area of 500 p and wind speed of 18 mph is 64.8 pounds. We can use this information to solve for k:

64.8 = k * 500 * 18²

Solving for k, we get:

k = 64.8 / (500 * 18²)

k = 0.0000768

Now, we can use the equation to find the force for a sail with an area of 250 f12 and a wind speed of 35 mph:

F = 0.0000768 * 250 f12 * 35²

F = 108.72 pounds

Therefore, the force on a sail with an area of 250 f12 and a wind speed of 35 mph would be 108.72 pounds.

Learn more about force

brainly.com/question/27660552

#SPJ11

Show your work for multiplying the polynomials below and put your answer in standard form in the box below: (No work loses points)
(x+6)(x2−3x−4)

Answers

The polynomials are multiplied to give the expression x³ + 3x² - 22x - 24

How to determine the product

We need to know that algebraic expressions are described as expressions that are composed of terms, variables, their coefficients, factors and constants.

Also, these expressions are made up of mathematical operations. They are listed as;

SubtractionMultiplicationDivisionAddition BracketParentheses

From the information given, we have the expression;

(x+6)(x2−3x−4)

expand the bracket, we get;

x³ - 3x² - 4x + 6x² - 18x - 24

add the like terms, we get;

x³ + 3x² - 22x - 24

Learn about algebraic expressions at: https://brainly.com/question/4344214

#SPJ1

How many 4-digit numbers have the second digit even and the fourth digit at least twice the second digit?

Answers

There are 1350 4-digit numbers that have the second digit even and the fourth digit at least twice the second digit.

To form a 4-digit number, we have 10 choices for each digit, except the first digit, which can't be 0. Hence, there are 9 choices for the first digit.

For the second digit, there are 5 even digits (0, 2, 4, 6, 8) to choose from.

For the third digit, there are 10 choices.

For the fourth digit, we can choose any of the even digits we picked for the second digit, or any of the larger odd digits 4, 6, 8.

Hence, the number of 4-digit numbers that meet the given criteria is

9 × 5 × 10 × 3 = 1350.

Therefore, there are 1,350 4-digit numbers that have the second digit even and the fourth digit at least twice the second digit.

To know more about 4-digit numbers:

https://brainly.com/question/679725

#SPJ4

HELP MARKING BRAINLEIST IF CORRECT

Answers

Answer:

21.5

Step-by-step explanation:

First we can solve for c using the pythagoreom theorem. (probably didn't spell that right)

A squared + B squared =  C squared

9 squared + 3 squared = c squared

81+9= c squared

90=c squared

90 square root is (rounded to the nearest tenth) 9.5

c=9.5

Then we can add 9.5+9+3= 21.5

Help me please I don’t know what to do

Answers

Answer:

179.3 square units

Step-by-step explanation:

We have to find the area of the rectangle and area of semicircle using the formula and then add the areas.

Area of rectangle:

                  length = 14 units

                   width = 10 units

          [tex]\sf \boxed{\text{\bf Area of rectangle = length * width}}[/tex]

                                             = 14 * 10

                                             = 140 square units

Area of semicircle:

                diameter of semicircle = width of the rectangle

                                                 d =  10 units

                                                 r = d ÷ 2

                                                    = 10 ÷ 2

                                                    = 5 units

                     [tex]\boxed{\text{\bf Area of semicircle = $\dfrac{1}{2}\pi r^2$}}[/tex]

                                                       [tex]\sf = \dfrac{1}{2}*3.14*5*5\\\\ = 39.26\\\\ = 39.3 \ square \ units[/tex]

Area of the figure = area of rectangle +  area of semicircle

                             = 140 + 39.3

                             = 179.3 square units

                 

Bill is walking up the steps in the Washington Monument at a rate of 30 feet per minute and Joe is walking down at the rate of 45 feet per minute. Bill is 75 feet from the bottom at the same moment that Joe is 325 feet from the bottom. Which of the following systems of equations can be used to determine the number of minutes t, from now and height, ℎ (in feet), at which they will pass each other?

Answers

The equation that can be used to determine the number of minutes t, from now and height, ℎ (in feet), at which they will pass each other is 75t = h.

What is the time taken for them to pass each other?

The time taken for them to pass each other is calculated as follows;

Apply the rules of relative velocity;

(V₂ - V₁)t = h

where;

V₂ is the velocity of the BillV₁ is the velocity of the Joet is the time taken for them to meeth is the distance between them

(30 ft/min - ( -45 ft/min )t = h

75t = h

Learn more about time of motion here: https://brainly.com/question/24739297

#SPJ1

8. A square has a side length of 11 V2 meters. What is the length of the diagonal
of the square?

Answers

The length of the diagonal of the square is 22 meters.

Define square

A square is a four-sided two-dimensional geometric shape in which all sides are equal in length and all angles are right angles (90 degrees).It is a unique instance of a rectangle with equal sides. The opposite sides of a square are parallel to each other and the diagonals bisect each other at right angles.

A square is divided into two 45-45-90 triangles by its diagonal.

In a 45-45-90 triangle, the hypotenuse (the side opposite the right angle) is √2 times as long as each leg.

Therefore, in this square, the length of the diagonal (d) can be found by multiplying the length of one side (s) by √2:

d = s√2

In this case, the side length of the square is 11√2 meters, so:

d = 11√2 × √2 = 11 × 2 = 22 meters

Therefore, the length of the diagonal of the square is 22 meters.

To know more about rectangle, visit:

https://brainly.com/question/28993977

#SPJ1

Pls help me find the exponent!

Answers

Answer:

1.6×10^-12..............

√50-√18+√8+√128-3√2
Please solve this

Answers

Step-by-step explanation:

the

answer

of

this

question

is

9 \sqrt{2}

Do you like this (^__^) ??

Luka and Janie are playing a coin toss game. If the coin lands heads up, Luka earns a point; otherwise, Janie earns a point. The first player to reach 25 points wins the


game. If 24 of the first 47 tosses have been heads, what is the probability that Janie wins the game?


The probability that Janie wins the game is I.


(Simplify your answer. )

Answers

Probability of Janie winning game = (2⁴⁷ - 1)/2⁴⁷  or approximately 0.999999999999978, using binomial distribution with given information.

How can we find the probability?

We can solve this probability by using the binomial distribution. Let X be the random variable representing the number of heads in the remaining tosses until one of the players wins the game. Since Luka has 24 points, Janie needs to win X heads before Luka wins one more.

We want to find the probability that Janie wins the game, which is the probability that X is greater than or equal to Luka's remaining points needed to win(25 - 24 = 1).

Let p be the probability of the coin landing heads up, and q be the probability of the coin landing tails up, so that p + q = 1. Since the coin is fair, p = q = 1/2.

Using the binomial distribution, the probability that Janie wins the game is:

P(X >= 1) = 1 - P(X = 0)

where

P(X = k) = [tex](47 - 24 choose k) (1/2)^k (1/2)^(47 - 24 - k)[/tex]

= (23 + k choose k) (1/2)⁴⁷

where k = 0, 1, 2, ..., 23.

Therefore,

P(X = 0) = (23 choose 0) (1/2)⁴⁷ = 1/2⁴⁷

P(X >= 1) = 1 - P(X = 0) = 1 - 1/2⁴⁷

Simplifying,

P(X >= 1) = (2⁴⁷ - 1)/2⁴⁷

Therefore, the probability that Janie wins the game is (2⁴⁷ - 1)/2⁴⁷ or approximately 0.999999999999978.

Learn more about Probability

brainly.com/question/29650749

#SPJ11

given a standard deck of cards, what is the probability of choosing a diamond, then a heart, then a black card if no replacement is made

Answers

Answer:The probability of both is 1/4*13/51.

Step-by-step explanation:

There are 52 cards in the deck, 13 hearts and 13 spades. The probability of getting a heart is 13/52 or 1/4. Given an initial heart there are 51 cards remaining; the probability of a spade is now 13/51

Rachel currently has $836 in a savings account that has earned 4. 5% annual compound interest for the past year. What was Rachel's beginning balance one year ago if she has made no other deposits during the year. $873. 62 $800. 00 $576. 55 $798. 38

Answers

Rachel's beginning balance one year ago if she has made no other deposits during the year is $800.00. Therefore, the correct option is 2.

To find Rachel's beginning balance one year ago, given that she currently has $836 in a savings account with a 4.5% annual compound interest rate, we'll use the compound interest formula:

A = P(1 + r/n)^(nt)

Where:

A = the final amount ($836)

P = the principal (beginning balance) - this is what we're trying to find

r = the annual interest rate (0.045 or 4.5%)

n = the number of times interest is compounded per year (assuming it's compounded annually, n = 1)

t = the number of years (1 year)

First, rearrange the formula to solve for P:

P = A / (1 + r/n)^(nt)

Now, plug in the values:

P = 836 / (1 + 0.045/1)^(1*1)

Simplify the equation:

P = 836 / (1.045)^1

Calculate the result:

P ≈ 800.00

So, Rachel's beginning balance one year ago was approximately $800.00 which corresponds to option 2.

Learn more about Compound interest:

https://brainly.com/question/28020457

#SPJ11

A circle is circumscribed around a regular octagon with side lemgths of 10 feet. Another circle is inscribed inside the octagon. Find the area. Of the ring created by the two circles. Round the respective radii of the circles to two decimals before calculating the area

Answers

The area of the ring is 1,462.81 square feet, under the condition that a circle is circumscribed around a regular octagon with side lengths of 10 feet.

The area of the ring formed by the two circles can be evaluated using the formula for the area of a ring which is

Area of ring = π(R² - r²)

Here
R = radius of the larger circle
r = smaller circle radius

The radius of the larger circle is equal to half the diagonal of the octagon which is 10 feet. Applying Pythagoras theorem, we can evaluate that the length of one side of the octagon is 10/√2 feet.
Radius of the larger circle is

R = 5(10/√2)
= 25√2/2 feet
≈ 17.68 feet

Staging these values into the formula for the area of a ring,

Area of ring = π(17.68² - 10²) square feet

Area of ring ≈ 1,462.81 square feet
To learn more about Pythagoras theorem theoretheore
https://brainly.com/question/343682
#SPJ4

Which is an expression in terms of π that represents the area of the shaded part of ⊙R

Answers

The expression in terms of π that represents the area of the shaded part of ⊙R is 3πR²/4, obtained by subtracting the area of the smaller circle from the larger circle.

How to find the area of the shaded region in terms of π?

To find the area of circle of the shaded part of ⊙R, we need to subtract the area of the smaller circle from the area of the larger circle.

The area of a circle is given by the formula A = πr², where r is the radius of the circle.

Let the radius of the larger circle be R and the radius of the smaller circle be r. Then the area of the shaded part can be expressed as:

A(shaded) = A(large circle) - A(small circle)

= πR² - πr²

We can simplify this expression further by noticing that the radius of the smaller circle is half the radius of the larger circle, so r = R/2. Substituting this into the equation gives:

A(shaded) = πR² - π(R/2)²

= πR² - πR²/4

= 3πR²/4

Therefore, the area of the shaded part of ⊙R can be expressed as 3πR²/4. This expression represents the difference in the area between the larger and smaller circles, which gives us the area of the shaded region.

Learn more about area of circle

brainly.com/question/28642423

#SPJ11

The expression in terms of π that represents the area of the shaded part of ⊙R is 3πR²/4, obtained by subtracting the area of the smaller circle from the larger circle.

How to find the area of the shaded region in terms of π?

To find the area of circle of the shaded part of ⊙R, we need to subtract the area of the smaller circle from the area of the larger circle.

The area of a circle is given by the formula A = πr², where r is the radius of the circle.

Let the radius of the larger circle be R and the radius of the smaller circle be r. Then the area of the shaded part can be expressed as:

A(shaded) = A(large circle) - A(small circle)

= πR² - πr²

We can simplify this expression further by noticing that the radius of the smaller circle is half the radius of the larger circle, so r = R/2. Substituting this into the equation gives:

A(shaded) = πR² - π(R/2)²

= πR² - πR²/4

= 3πR²/4

Therefore, the area of the shaded part of ⊙R can be expressed as 3πR²/4. This expression represents the difference in the area between the larger and smaller circles, which gives us the area of the shaded region.

Learn more about area of circle

brainly.com/question/28642423

#SPJ11

A fountain is in the shape of a right triangle. The area of the fountain is
12 square meters. One leg of the triangle measures one and a half times the
length of the other leg. What are the lengths of all three sides of the fountain?

Answers

Answer:

4,6,[tex]\sqrt{52} \\[/tex]

Step-by-step explanation:

Area of right triangle= base x height/2=12, but if we remove the division then it's:

base x height=24

factors of 24= 6,4  8,3 24,1 and 12,2

we have the rule that "One leg of the triangle measures one and a half times the length of the other leg." and the pair that matches that is 6 and 4.

So leg a=4 and leg b=6. Using the Pythagorean theorem(a^2+b^2=c^2) we have:

4^2+6^2=c^2=16+36=52 so the answer is 4,6,[tex]\sqrt{52} \\[/tex]

Calculate A. ∂z and ∂x
B. ∂z and ∂y
at the point
(5, 17, 1)
where z is defined implicitly by the equation
z4 + z2x2 − y − 9 = 0

Answers

At the point (5, 17, 1), the partial derivatives of z with respect to x and y are -12.5 and 0.25, respectively, as calculated using implicit differentiation. At the point (5, 17, 1), the partial derivatives of z with respect to z and y are 0.16 and -1.

To find the partial derivatives, we need to use the implicit differentiation.

To find ∂z/∂x, we differentiate the equation with respect to x, treating y and z as functions of x

4z^3(dz/dx) + 2z^2x^2 - 0 - 0 = 0

Simplifying, we get

4z^3(dz/dx) = -2z^2x^2

(dz/dx) = -1/2x^2z

At the point (5, 17, 1), we have

(dz/dx) = -1/2(5)^2(1) = -12.5

To find ∂z/∂y, we differentiate the equation with respect to y, treating x and z as functions of y

4z^3(dz/dy) - 1 - 0 + 0 = 0

Simplifying, we get

4z^3(dz/dy) = 1

(dz/dy) = 1/4z^3

At the point (5, 17, 1), we have

(dz/dy) = 1/4(1)^3 = 0.25

To find ∂z and ∂y at the point (5, 17, 1), we need to take partial derivatives with respect to z and y, respectively, of the implicit equation

z^4 + z^2x^2 - y - 9 = 0

Taking the partial derivative with respect to z, we get

4z^3 + 2z^2x^2(dz/dz) - dy/dz = 0

Simplifying and solving for ∂z, we get

∂z = dy/dz = 8z^3/(2z^2x^2) = 4z/x^2

At the point (5, 17, 1), we have

z = 1, x = 5

So, ∂z at the point (5, 17, 1) is

∂z = 4z/x^2 = 4(1)/(5^2) = 0.16

To find ∂y, we take the partial derivative with respect to y, keeping x and z constant

-1 = ∂y

Therefore, ∂y at the point (5, 17, 1) is -1.

To know more about partial derivatives:

https://brainly.com/question/31397807

#SPJ4

Other Questions
this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY Determine the measure of arc cad thanks grade 9-10-11 it is either 240 or 260 Basic body color for wolves is influenced by several genes, one of which has several different alleles. Two of these alleles-white coat and black coat-display incomplete dominance. A wolf is heterozygous for these two alleles displays a gray coat. Is it possible to produce a line of pure-breeding gray wolves? Why or why not?Incomplete dominance: blended traits IreadyHow were adventure playgroundsof the 1960s different fromplaygrounds of the 1920s? If your starting salary is $50,000 and you receive a 4% increase at the end ofevery year, what is the total amount, in dollars, you will earn over the first 16years that you work?Round your answer to the nearest whole dollar, and express your answerwithout using commas.Answer hereSUBMIT 13. If the supply of gasoline rises, name a substitute that will increase in demand? 14. How do you think each of the following affected the world price of oil? List if it will effect supply or demand, and the price change if any. Use basic supply and demand analysis. a. Tax credits were offered for expenditures on home insulation. b. The Alaskan oil pipeline was completed. c. Oil was discovered in Mexico and the North Sea. d. Sport Utility Vehicles and minivans became popular. e. Natural oil reserves became depleted Which is the BEST way to distribute aerobic activity throughout the week? one long session in a single day two equally long sessions separated by several days several equally long sessions spread over the week. several equally long sessions in one or two days Explain the key differences (not just the definitions) between the four functional areas of theorganization. Also, explain why we need all four areas for a business to prosper. verify that the equation is an identity. 2cosx2x/sin2x=cotx-tanx Find the Differentials of1) z = x^2 - xy^2 + 4y^52) f(x,y) = (3x-y)/(x+2y)3) f(x,y) = xe^x3y f(x)=2x-5xg(x)=2x-1Find (f- g)(x) Add 2 1/3 + 4 5/8 writ your answer as a mixed number which of the following is considered a flexible expense ?a. Restaurant mealsb. rent payment for apartment.c. Credit card payment.d. Car insurance payment. he outflow channels on mars indicate a flood period in the history of mars. during this time, based on the width and depth of the remaining riverbed, it is thought that the flow rate must have been: a) just a small trickle, barely more than a stream of water. b) moderate, about the flow rate of the ohio river. c) fairly large, about the flow rate of the current colorado river. d) significantly large, about the flow rate of the amazon river. e) enormous, as much as 100 times the flow rate of the amazon river 4.Rachel intends to serve regional food at this presentation. Should she serve it at the beginning of the presentation. At the end? Or as she discusses each region? What is the rationale for your answer? Question is in the image. Please help me solve these mushrooms are decomposers for most north texas food chains.which description best describes how mushrooms would be incorporated into the food chain?all of the tertiary consumers will have an arrow pointing at the mushrooms because tertiary consumers are at the top of the food chain and transfer their energy to the decomposersall of the producers will have an arrow pointing at the mushrooms because decomposers receive their energy only from producersall of the organisms will have an arrow pointing at the mushrooms because decomposers receive their energy from all living things.an arrow will point from the mushrooms to the primary consumers because primary consumers are herbivores and eat mushrooms for energy In a box of nerds candy, the ratio of pink to purple candies is 19:20. if there are 429 pieces of candy in the box, how many are pink?