Jim is going from Town A to Town B. Town B is located at (-4, 5). He makes a stop at his friend’s house, which is halfway along the trip. What are the coordinates of his stop?

Answers

Answer 1

Answer:

tạo độ của anh ấy dừng là:

Step-by-step explanat ion(:-2,2.5)


Related Questions

In ADEF, the measure of measure of ZD to the nearest degree.
E
52
X
F
D
14

Answers

Answer:

74 degrees

Step-by-step explanation:

Assuming we have the following

FD = 14

DE = 52

m<F = 90degrees

Required

m<D

DE = hypotenuse

FD = adjacent

Using the SOH CAH TOA identity

Cos m<D = adj/hyp

Cos m<D = 14/52

m<D = arccos(0.2692)

m<D = 74.38

m<D to the nearest degree is 74degrees

1) What is the value of x + 2 in this equation?
7(x + 2) = 77
2 + 2 =

Answers

7(x+2)=77
7x+14=77
-14=-14
7x=63
_. _
7. 7
X=9

please help


Will mark brainlist

Answers

I think answer is b that is 10raise to 2

Please help!!!
Which quadrant is -3,-3 located on a coordinate plane?
Quadrant 1
Quadrant 2
Quadrant 3
Quadrant 4

Answers

Answer:

Quadrant 3

Step-by-step explanation:

How much would $125 invested at 8% interest compounded continuously be
worth after 16 years? Round your answer to the nearest cent.
A(t)= P*e^rt

Answers

Answer:

449.58

Step-by-step explanation:

125e^(0.08)(16)

use desmos scientific caclulator

Celular limpio es frase o oracion

Answers

Answer:'

Frase

Step-by-step explanation:

Frase

HELP ME WITH THIS PLEASE :)

Answers

Answer:

1) F

2) C

3) A

4) H

Step-by-step explanation:

1)

P = a + b + c + d

P = 7x + 8 + 7x + 8 + 9x + 4 + 12x - 2

P = 35x + 18

2)

P = 4a

P = 4(4x - 8)

P = 16x - 32

3)

P = 5a

P = 5(2x - 4)

P = 10x - 20

4)

P = 4a

P = 4(7x + 2)

P = 28x + 8

Please help I can’t fail

Answers

Answer:

B

Step-by-step explanation:

line b is the closest to all the points on the graph

I NEED HELP ASAP
A football quarterback goes for a two-point conversion when the ball is within 10 yards of the end zone. During the game, he has two opportunities for a two-point conversion. He misses the first attempt 50% of the time. When he misses the first attempt, he misses the second attempt 15% of the time. What is the probability of missing both two-point conversion attempts?

Answers

Answer:

P = 0.075     P = 7.5%

Step-by-step explanation:

We pretty much look for the probability that the player fails the first attempt and also fails the second attempt.

We know for a fact that the probability that the quarterback fails the first attempt is:

p(1) = 0.5

and we know that the probability that the quarterback fails the second attempt after failing the first is:

p(2/1) = 0.15  

Then the probability of failure of both attempts is:

P(2/1) = p(1 and 2) / p(1)

p(1 and 2) = P(1) * P(1/2)

p(1 and 2) = 0.5 * 0.15

and that is

p(1 and 2) = 0.075

you probably didn't want the nerdy stuff but oh well

Answer:

Answer:

P = 0.075     P = 7.5%

Step-by-step explanation:

We pretty much look for the probability that the player fails the first attempt and also fails the second attempt.

We know for a fact that the probability that the quarterback fails the first attempt is:

p(1) = 0.5

and we know that the probability that the quarterback fails the second attempt after failing the first is:

p(2/1) = 0.15  

Then the probability of failure of both attempts is:

P(2/1) = p(1 and 2) / p(1)

p(1 and 2) = P(1) * P(1/2)

p(1 and 2) = 0.5 * 0.15

and that is

p(1 and 2) = 0.075

Marsha deposited 7500 into a savings account 5 years ago. The simple interest rate is 3%. How much money did Marsha earn in interest

Answers

Answer: $1125

Step-by-step explanation: 7500 x 3%=  225   Then multiply 225 by the 5 years. You will then get 1125.  Marsha earned $1,125 in interest.

I hoped this helped, have a great rest of your day!

Answer:

$1125

Step-by-step explanation:

plz crown

The plane has traveled 105 miles which is 45%of the distance it needs to go. How many miles is the total distance of the flight?

Answers

Answer: 162.75 miles

Step-by-step explanation: 100%-45%=55%

55%=.55

105 times .55= 57.75

105+57.75= 162.75

sorry but I'm not sure if its right because I haven't does one of these in a while

2. Let u = <4, 8>, v = <-2, 6>. Find u + v. (1 point)

Answers

Answer:

u+v = (4,8)+(-2,6)

=(4-2, 8+6)

=(2, 14)...This is the required answer.

Which set of data points could be modeled by a line of best fit that is a decreasing linear function?
A. {(0, 0), (1, 8), (2, 15), (3, 22), (4, 30)}
B. {(0, 5), (1, 6), (2, 10), (3, 16), (4, 28)}
C. {(0, 50), (1, 42), (2, 33), (3, 25), (4, 16)}
D. {(0, 64), (1, 60), (2, 52), (3, 39), (4, 22)}

Answers

Answer:

c I do believe

Step-by-step explanation:

can you help me with this question is the correct answer b

It’s C becausw if u

Explanation:

Answer: thx pass some points !

Please help I’m so stressed over this ok here it is it cost $12.50 to enter an amusement park and $1.50 to play each game. Solve an inequality to find the number of games, g, Cole can play if he has $35 to spend at the park. Enter your answer in the box.

Answers

Answer:
He can go on 15 gams

Thank y’all for help

Answers

Answer:

Ask a question so I can answer it -_-

Step-by-step explanation:

1,2,5 please I don’t really understand this lesson :(:/
AKA 1,2,5 only!

Answers

Answer:

Step-by-step explanation:

Volume of a triangular pyramid = [tex]\frac{1}{3}(\text{Area of the triangular base})(\text{Height})[/tex]

1). Volume of the pyramid = [tex]\frac{1}{3}(72)(15)[/tex]

                                           = 360 cm³

2). Volume of the pyramid = [tex]\frac{1}{3}(\text{Area of the triangular base})(\text{Height})[/tex]

   Area of the triangular base = [tex]\frac{1}{2}(\text{Base})(\text{height})[/tex]

                                                 = [tex]\frac{1}{2}(8)(5)[/tex]

                                                 = 20 cm²

   Therefore, volume of the pyramid = [tex]\frac{1}{3}(20)(12)[/tex]

                                                             = 80 cm³

5). Volume of the cone = [tex]\frac{1}{3}\pi r^{2}h[/tex]

    Here, r = radius of the circular base

    h = Height of the cone

    Volume of the cone = [tex]\frac{1}{3}\pi (2)^2(4)[/tex]

                                      = [tex]\frac{16\pi }{3}[/tex]

                                      = 16.76 cm³

How many different 2-digit numbers can be formed from the digits 4, 6, and 8?

Answers

Answer:

12 two

24 and 42 represent one combination, but 2 permutations. Thus, the number of two-digit numbers that can be made with the digits 2, 4, 6, and 8 is: Therefore, 12 two-digit numbers can be made with the digits 2, 4, 6, and 8.

Step-by-step explanation:

please mark this answer as brainliest, leave a 5-start rating, and give a thanks

The number of 2-digit numbers can be formed from the digits 4, 6, and 8 is 18.

What is the Permutations?

Permutations are different ways of arranging objects in a definite order. It can also be expressed as the rearrangement of items in a linear order of an already ordered set. The symbol nPr is used to denote the number of permutations of n distinct objects, taken r at a time.

The given digits are 4, 6 and 8.

We know that, P(n, r)= n!/(n-r)!

Here, n=3 and r=2

Now, 3!/(3-2)!

= 3×2

= 6

Using C(n, r)= n!/r!(n-r)!

Now, 3!/2!(3-2)!

= 3

So, 6×3

= 18

Therefore, the number of 2-digit numbers can be formed from the digits 4, 6, and 8 is 18.

To learn more about the permutation visit:

https://brainly.com/question/3867157.

#SPJ6

There are 8 sophomores on the academic team. At the last competition, they each took the math test. Their scores were 82%, 92%, 76%, 72%, 92%, 74%, 80%, and 78%. What was the median math score of the sophomores? 79% 82% 87% 92%

Answers

The median of the math scores is = 79%.

You can understand more about calculation of median of a set of numbers below.

Estimation of median scores

The total number of sophomores is = 8

The percentage score of each sophomore = 82%, 92%, 76%, 72%, 92%, 74%, 80%, and 78%.

To calculate the median of the percentage scores, arrange the scores in ascending order and pick the figure in the middle as the median math score.

72, 74, 76, 78, 80, 82, 92, 92

Here the median is two figures 78, and 80 which are located in the middle. The median is =>78 +80/2

= 158/2 = 79%

Therefore, the median of the math scores is = 79%

Learn more about median calculation here:

https://brainly.com/question/14532771

-----------------------

A. 79%

edge 2022 :)

------------------------

can someone please help with this? real answer only please......ive asked multiple questions today becuz i dont really understand the assignment, please help​

Answers

i believe the answer is A

Please please help!!! Giving brainiest

Answers

Answer:

8.8 ounces

Step-by-step explanation:

3.96 ÷ 0.45 = 8.8

she bought 8.8 ounces of ground coffee

HELP ME PLEASEEEE NO LINKS OR IMMA REPORT WORTH 15 POINTS

Answer choices are

1.The same or diffrent, diffrent

2. Corresponding angles, the complementary to a corresponding angle, The supplementary to a corresponding angle, The vertical angle to a corresponding angle, they are not corresponding in anyway

Answers

Answer: 1=same

Step-by-step explanation: because if you line them up they are all the same size

3-108. Write an equation and find the answer for each of the following problems. Give answers in decimal form. Homework Help a. What is the product of three tenths and four hundredths?​

Answers

product means multiply, so 3/10 * 4/100 = 12/1000, simplified is 6/500

Para reformar la cocina de su caja Berta compro la semana pasada 2 cajas de plaquetas para el suelo y 4 de azulejos para la pared por 200 €. Hoy la comprado 2 cajas más de plaquetas y otras 2 de azulejos per 130 € Cuanto cuesta la caja de plaquetas y la de azulejos

Answers

Answer:

Caja de plaquetas = x = 30 €

Caja de azulejos = y = 35 €

Step-by-step explanation:

Deje que el costo de

Caja de plaquetas = x

Cuadro de mosaico = y

Por Berta

Para reformar su cocina, Berta compró la semana pasada 2 cajas de baldosas de plaquetas para el suelo y 4 cajas de baldosas para la pared por 200 €.

2x + 4y = 200 ...... Ecuación 1

Hoy

Hoy compré 2 cajas más de plaquetas y otras 2 de tejas por 130 €.

2x + 2y = 130 ..... Ecuación 2

Resolvemos usando el método de Eliminación

2x + 4y = 200 ...... Ecuación 1

2x + 2y = 130 ..... Ecuación 2

Restar la ecuación 2 de 1

2 años = 70

y = 70/2

y = 35 €

Resolviendo para x

2x + 4y = 200 ...... Ecuación 1.

2x + 4 × 35 = 200

2x + 140 = 200

2x = 200 - 140

2x = 60

x = 60/2

x = 30 €

el costo de

Caja de plaquetas = x = 30 €

Caja de azulejos = y = 35 €

What is the value of x? NEDD HELP ASP

A x=15

B x=30

C x=37.5

D x=52.5

Answers

Answer:

The value of x is 15 .

Option (A) is correct.

Step-by-step explanation:

As given

∠1 and ∠2 are complementary.

i.e the sum of ∠1 and ∠2 is 90° .

Thus

∠1 + ∠2 = 90°

x° + (3x+30)° = 90°

x + 3x + 30 = 90

4x = 90-30

4x = 60

x = \frac{60}{4}x=

4

60

x = 15

Therefore the value of x is 15 .

Option (A) is correct.

Answer:

A. x=15

Step-by-step explanation:

To solve this problem, we can combine like terms.

3x + (1)x are like terms.

3x + (1)x = 4x.

Since 3x and (1)x are the only pair of like terms, we are done with this step.

Complementary angles have a sum of 90°.

4x + 30 = 90.

Next, we subtract 30 from 90.

90 - 30 = 60.

Then, we divide 60 from 4.

60 / 4 = 15.

15 is the final answer.

Therefore, the value of x is 15.

If Jeff is a manager at the local movie theatre, his annual salary is $46,000 and his company gives a 1.5% raise each year. What will be the total amount of money Jeff earns in 4 years assuming he gets the raise each year?

Answers

Answer:

59000

Step-by-step explanation: yep

Hey guys. So I'm doing a basic program for a battle game in Javascript, and I've having trouble on this one question. (subtraction)

If I have one number like 20, then 3 numbers such as 2, 4 and 7, I could easily find out which number in those 3 i subtracted by. For example if I had 18 as the answer, then I could do 20 - 18 and get 2 from the 3 numbers.

But how do I do that twice? or three or more after that one time? how would I know which one I picked after? (after the number is used once, it can still be used forever on, it's always random)

Answers

Answer:

can i show you how to do it

Step-by-step explanation:

which number lies half-way between 356 and 1025​

Answers

Answer is 695

(365+1025)/2= 695

Please help with these 2 range questions ❤

Answers

Answer:

10) 27

15) 18

Step-by-step explanation:

10)

Range = Max value - Min value

18 = x - 9

x = 27

15)

Range = Max value - Min value

32 = 50 - x

-x = 32 - 50

-x = -18

x = 18

Answer:

27 and 18

Step-by-step explanation:

The range is the difference between the largest and smallest numbers

(10)

Given range = 18 and smallest number is 9 then

largest number = 9 + 18 = 27

(15)

Given range = 32 and largest number is 50 , then

smallest number = 50 - 32 = 18


someone help with the first one

Answers

Answer:

45

Step-by-step explanation: 180- 135

Answer:

<L = 45

<N = 135

Step-by-step explanation:

<L + 135 = 180

<L = 180 - 135

<L = 45

<N = 135 because of vertical angles

A storage shed with a flat roof is 12 feet long by 9 feet wide by 4 1/2 feet tall.
How many cubic feet of storage space does the shed enclose?

Answers

Answer:

To get the volume of the shed in yards, multiply 4*3*2.5=30

since one cubic yard is equal to 27 cubic feets, multiply 27 with 30 to get the volume in cubic feets 27*30=810

Step-by-step explanation:

Other Questions
Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest