Number of gametes produced after meiosis:The diploid reproductive cell is a (n):

Answers

Answer 1

Answer:

Four haploid cells.

Explanation:

These reproductive cells are produced through a type of cell division called meiosis. During meiosis, a diploid parent cell, which has two copies of each chromosome, undergoes one round of DNA replication followed by two separate cycles of nuclear division to produce four haploid cells.

Hope this helps! Brainliest?? Anyways have a great day! :))


Related Questions

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

Help me with this please

Answers

C can be the possible answer!

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. ... The G2 checkpoint ensures all of the chromosomes have been replicated and that the replicated DNA is not damaged before cell enters mitosis.

A mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Tumor suppressor genes are normally expressed genes that control the progression of a cell through the cell cycle.

These genes (tumor suppressor genes) act to repair mutations that occurred during DNA replication, slow down cell division, activate programmed cell death pathways (i.e., apoptotic pathways, etc).

For example, p53 is a tumor suppressor gene capable of controlling cell division rate by keeping cells from proliferating in an uncontrolled manner.

In consequence, mutations of the p53 gene are often observed in cancer cells that lost their ability to regulate the rate at which they grow.

In conclusion, a mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Learn more in:

https://brainly.com/question/16188646

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%

Answers

Answer:

C, 10%

Explanation:

For the year of 2010, it's definitely 10%

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

what does not pass through the stomata of leaves ​

Answers

Carbon dioxide and oxygen cannot pass through but move in and out

Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________

Answers

Answer:

vibrating vocal cords, stomping feet, gargling, whistling, cracking your knuckles

Answer:

•shouting•talking•singing•playing instruments•laughing•yelling•screaming•crying

Explanation:

yAn LNG po Alam ko e:^

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Answers

Explanation:

1. b-a-c

2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.

3. Helicase

4. DNA Polymerase

5. Option D

6. Option C

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

State one way by which Carbon Dioxide decreases in the atmosphere

Answers

Answer:

The early atmosphere was mainly carbon dioxide and water vapour. Water vapour condensed to form the oceans. Photosynthesis caused the amount of carbon dioxide to decrease and oxygen to increase.

Hope it helps!!!

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

Why is it we cannot directly observe a genotype, but can sometimes infer it?

Answers

We cannot directly observe a genotype because there are multiple options for genotypes.

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea
Other Questions
Hey thereHow might Stacey feel when T. J. comes to the Logan house in the middle of the night? Describe a connection that helps you answer the question. Not sample response 4/7(21/8 x + 1/2) = -2(1/7 - 5/28x)What is x in decimal form? 2. Read the passage given below and answer the questions/complete thesentences that follow.Power foods are foods that provide rich levels of nutrients like fibre, potassium andminerals. With people becoming increasingly health conscious today, a lot of finesstrainers encourage their clients to include these foods in their daily diet to increasemuscle development. There are various ways of incorporating power foods in yourdaily diet. Of course, the key to enjoying power foods is proper preparation of thesefoods, the use of season-fresh foods, and indentifying your choice of flavour amongpower foods.Some of the recommended power food combinations are those that are prepared inour kitchens on a regular basis. Take for instance, the combination of chickpeas andonions. This combination is a powerful source of iron which is required by the body totransport oxygen to its various parts. Iron deficiency can lead to anaemia, fatigue,brain fog and tiredness. A study by the Journal of Agricultural and Food Chemistrysays that sulphur compounds in onion and garlic help in the absorption of iron andzinc from chickpeas. The combination is a hit with teenagers who need to be diligentabout getting iron in their diet. A quick way to prepare this power food is to make achickpea salad with chopped onions, chaat masala and cilantro.Another favourite combination with power food takers is yoghurt and bananas. Thismakes for a perfect snack after a rough game of football. Exercising bums glucoseand thus lowers blood sugar. Yoghurt is packed with proteins that help preservemuscle mass, and bananas are packed with carbohydrates that help in refuellingenergy and preventing muscle soreness. A quick and easy recipe with bananas is abanana smoothie topped with cool yoghurt.Among beverages, green tea is the best source of catechins that are effective inhalting oxidative damage to cells. According to researchers at the Purdue University,adding a dash of lemon juice to green tea makes the catechins even more easilyabsorbable by the body. So, the next time you have instead of are friends serve themrounds of iced green tea with mint and lemon juice.A) What are power foods?B) What are the rules regarding the partaking of power foods?C) What is the advantage of including onions and garlic in our diet?D) Suggest a quick recipe with chickpea and onions.E) Why is yoghurt and bananas, an enriching power food?F) Why is green tea a recommended power food?G) What is the advantage of combining green tea with lemon juice?H) What is the key to enjoying power foods in a wholesome way? A bag contains 8 red pens, 7 blue pens, and 14 black pens. Denato wants to pull a blue pen from the bag. What is the sample space for this experiment? Write the complementary sequence for this strand of DNA:ATTCGCAT Electric cables for your lamp have a plastic rubber coating around the wire. Explain why this material surrounds the metal cable.This is 100 points Can anyone help me with 6? Please A mixture of 2.0 moles of H2, 2.0 moles of NH4, 4.0 moles of CO2, and 5.0 moles ofN2 exert a total pressure of 800 torr. What is the partial pressure of each gas in themixture respectively? Think of a time when you wanted to speak up but didn't. Explain in detail how you felt and what you wish you had said. Explain why you chose not to speak and if you would make the same choice again. 1. Find the area of the composite figure to the nearest hundredth.55 mm32.5 mm12.5 mm12.5 mmtotal area =mm? Find the volume of the prism?* An individual who exhibits a mixture of schizophrenic symptoms most likely has undifferentiated schizophrenia. Please select the best answer from the choices provided OT OF Answer the question please which of the following shows numbers in order from least to greatest The velocity of an object consists of its speed and..A. Average speedB. DistanceC. Displacement D. Direction Which of the data sets below has a mean of 32? Select all that apply.A) 45, 21, 33, 29B) 18, 54, 24C) 14, 56, 34, 18, 23D) 34, 35, 21, 29, 46 What is the volume of a hemisphere with a radius of 3.1 in, rounded to the nearest tenth of a cubic inch?Pls help me Please help! No links or spam, I will report. write an expression to show that is equivalent to 14x + 7y Jefferson purchased a jacket originallypriced $129 on sale for $90.30. What was thepercent of discount? jared and zach worked all day saturday mowing lawns they earned a combined of $43 how much did each boy get