of the core elements of successful safety health programs, management leadership, worker participation, and what else directly relate to individual roles

Answers

Answer 1

Answer:

can you clarify?

Explanation:


Related Questions

Which description
best defines health?

Answers

Answer:

“Health is a state of complete physical, mental, and social well-being and not merely the absence of disease or infirmity.

Explanation:

which anatomic structures define the pelvic inlet?

Answers

The pelvic inlet is the superior aperture of the pelvis. The anatomic structures that define the pelvic inlet include the sacral promontory, the superior border of the pubic symphysis and arcuate lines.

The pelvic inlet is a planar surface that determines the boundary between the pelvic cavity and the abdominal cavity.

The pubic symphysis is a joint composed of a fibrocartilaginous disc located between the left and right pubic bones.

The sacral promontory is an anterior projection of the sacral plateau, which forms the posterior margin of the pelvic inlet.

The arcuate line is a rounded border on the internal surface of the ilium, which forms the border of the pelvic inlet.

Learn more in:

https://brainly.com/question/13870358?referrer=searchResults

What are some of the issues that prevent people from maintaining a successful exercise program?

What are some of the specific roadblocks that make it more difficult for you to exercise? (i.e. no access to a gym, time, getting motivated, etc).

Answers

Answer:

There are several reasons it's hard to maintain an exercise program.

Explanation:

It'll be easier if I just do a bullet-point list:

No access to a gymBuilding off access to a gym--they may have access to a gym but no transportation or means of getting there. No time--either gyms aren't open at the right time or work/life gets in the wayNo motivationNo one to exercise with (some people need a gym buddy to help keep motivation up)Money--most gyms require a membershipWhen most people start an exercise program, especially to lose weight, they can see dramatic drops in their weight, but eventually this can plateau, which then turns them off exerciseAlso people can see a lot of gains in strength, but unless you structure your workout properly and increase the load/intensity at the right time, that too will taper off and once you can't see the crazy gains you might have gotten earlier, it discourages you. Self-esteem can play a factor, especially if someone is overweight and wants to work out and lose weight, but then they get self-conscious about their body, especially seeing people who are in-shape working out and not as many people who look like them working out. Lack of variety in the gym--some are heavily strength-based, some don't have enough equipment or the proper equipment.

These are just some common reasons I've heard or I've experienced that I could think of right off the top of my head. Hope that's enough to work with!

There are innumerable explanations, and they are analogous to exercise and pain. Time is the top excuse for not exercising. Plan your day around your exercise schedule, not vice versa.

Why do most people fail to excersise?

Exercise is difficult for many reasons. Some of the reasons are listed below:

They may have gym access but no way to get there.No time—gyms aren't open or work/life interferes.ApathyExercise alone (some people need a gym buddy to help keep motivation up)Gym memberships cost money.When people start an exercise program, especially to reduce weight, they experience substantial weight declines, but this can plateau, turning them off activity.People can see a lot of strength improvements, but unless you structure your workout properly and raise the load/intensity at the perfect moment, that too will taper off and discourage you.Self-esteem can play a role, especially if someone is overweight and wants to go out and lose weight, but gets self-conscious about their physique, especially seeing fit people working out and not as many people who look like them working out.Some gyms are highly strength-based, and others lack equipment.

Learn more about excersie, here:

https://brainly.com/question/14429776

#SPJ5

how long can freshly pumped breast milk sit at room temperature

Answers

Freshly pumped breast milk can sit at room temperature for at least 4 hours before spoiling. :} Learned from experience

What are some reasons teens engage in risky behaviors such as smoking, drinking

Answers

Answer:  

Risk factors include (1) high tolerance for deviance, (2) unconventional attitudes and behaviors such as early alcohol use and precocious sex, (3) peer norms for deviance, (4) high sensation seeking, and, to a lesser extent, (5) disturbed risk perception and positive beliefs about alcohol.

Explanation:

What are examples of individual team sports?

Answers

Examples of individual sports include boxing, wrestling, golf, fencing, martial arts, tennis, ice skating, skiing, rodeo events and much more.

Answer:

Fencing, martial arts, and tennis are all examples of individual team sports.

Explanation:

Hope this helps ^w^

At the end of the semester, Andrea has to give an oral report in front of the whole class. She practices, but when she stands up, she gets so nervous she drops all of her notes. She is embarrassed and cannot seem to put them back in the proper order. After the presentation, she whispers to her classmate, "This is the worst day ever. I am so embarrassed.”

What response would express empathy toward Andrea?

“Hopefully you will still get a good grade.”
“I don’t think anyone was paying attention anyway.”
“That looked really painful. Do you want to talk?”
“Next time, have a backup plan.”

Answers

Answer:

"That looked really painful, do you want to talk"

Explanation:

got it right on edge after I used the answer above me >:C

"That looked really painful. Do you want to talk?” is the response that would express empathy towards Andrea. Therefore, option (C) is correct.

What is empathy?

Empathy is the ability to comprehend or experience what another person is feeling from inside their frame of reference; more specifically, it is the ability to put oneself in the perspective of another person.

Examples of empathy include being able to sense the happiness of another person and actually being glad for them, being able to see yourself in the same circumstances as another person who is having difficulty, and feeling sad when they feel sad.

Learn more about empathy, here:

https://brainly.com/question/14669414

#SPJ2

7. Why are light intensity activities not considered towards meeting daily physical activity needs?​

Answers

The intensity of physical activity is related to how hard our body works while doing that activity. Typically, the intensity of physical activity can be described as light, moderate or vigorous. However, light intensity activities are those that require standing up and moving around, either in the home, workplace or community, etc.

Answer:

The intensity of physical activity is related to how hard our body works while doing that activity. Typically, the intensity of physical activity can be described as light, moderate or vigorous.  Light intensity activities are those that require standing up and moving around, either in the home, workplace or community.

Explanation:

Hope this helps.

Which protein is given the superior name and why?

Answers

Answer:

Whey protein

Explanation:

Whey makes up 20% of the protein found in milk, but it's the superior protein for muscle building because it's absorbed quickly and causes a large and fast spike in blood amino-acid levels

Get on all fours on your mat with your head parallel to the floor. Exhale, arch your back and tuck your chin to your chest. Inhale and drop your stomach towards the ground while lifting your head as much as you can, stretching your neck. Describes what stretch?

Answers

Answer: Why wouldn't you just do this? All you have to do is get on the floor.

Explanation:

in general, what do students and staff think about how many students drink?

Answers

Answer: In general, what do students and staff think about how many students drink?  They think that fewer students are drinking than really are

Explanation:

Quiz for health how do you get rid of hiccups?

Answers

Answer:

drink a bunch of water without breathing

Explanation:

or stop slow down and take deep breaths

Resting metabolism includes your basal metabolism.
True
False

Answers

Answer:

False. Hope this helps.

there is a definitive test for each component of skill related fitness

T/F

Answers

Answer:

True

Explanation:

Specificity targets particular skill-related fitness components for improvement. There is a definitive test for each component of skill-related fitness

Have a great day! Hope this helps! : )

Which of the following things are included in a systems approach to problem solving? Check all of the boxes that apply.

defining problems in a system

randomly firing workers because they have been in a system the shortest amount of time

analyzing problems and solutions

implementing solutions without following up on how they are affecting a system

testing solutions to understand how they affect a system

Answers

Answer:

1, 3 and 5 <3

Explanation:

Answer:

Explanation:

1. defining problems in a system

3. analyzing problems and solutions

5. testing solutions to understand how they affect a system

5. Type the correct answer in the box. Spell all words correctly. Which US government recommendations can help you maintain a healthy, balanced diet?​

Answers

Answer:

Hacer ejercicio en forma regular y controlar el peso.

No fumar.

NO tomar mucho alcohol y evitarlo por completo en caso de tener antecedentes de alcoholismo.

Utilizar los medicamentos recetados por su proveedor de atención médica según las instrucciones.

Consumir una dieta saludable y equilibrada.

Explanation:

when watching a movie, we feel sorrow when the main character is sad and experience joy when he or she triumphs over adversity.

Answers

Answer:

no we experience hippieness

Explanation:

.

The body is divided into equal vertical left and right halves by the:

Answers

Sagittal plane

explanation

Which strategy can a state health department imitate to improve health?

Answers

Answer: First is wearing masks at all time when around a patient. Cleaning extra thorough and always washing hands. More hospital beds and ventilators. Finally doctors should get every health shot (Example: Covi.d Shot) that is approved by the FDA.

Brainliest if you liked the answer.

Answer: Inspect and license health facilities that provide services to people.

I’ve haven’t gotten a brainliest yet and it would be nice if I could get it! Hope this helped you!

PLEASE HELP ME I NEED HELP RN!!!!

Miguel is an elite Olympic athlete. He swims for about six hours each day and is considered to be in fantastic health. What is likely TRUE about his resting heart rate?
A. His heart rate is over 100 per minute
B. He has a higher rate than most non-athletes
C. His heart rate falls between 40 and 60 per minute
D. His resting heart rate and his target heart rate are the same number

Answers

Answer:

Its B

Explanation:

Mark me brainiest please!!!

i would say A is the answer

how effective is the moderna vaccine after 6 months

Answers

My mom has the Moderna vaccine, and she got the Coronavirus. I know that the vaccines don't completely protect against it, but my mom had it a lot worse than my dad. I hope this helps.

do you have any advice on how to get over social anxiety, trust issues, and depression?

im tired of being so alone, i want friends or at least one but i'm terrible at interacting with people in person lol

Answers

Answer:

1. Work with their emotions

The key thing to remember is that anxiety is not a rational disorder. Therefore, a rational response will most likely not help, especially during a moment of distress. Instead, try to work with the emotions. Accept that they feel anxious and, rather than being direct, be patient and kind. Remind them that while they may feel distressed, the feeling will pass.

Work with the irrational thoughts and acknowledge that the person is worried. For example, try something like: “I can understand why you feel that way, but I can assure you that it’s just your anxiety. It isn’t real.”

2. Focus on their feelings

Don’t ask why the person is feeling anxious. Instead, ask them how they are feeling. Encourage them to list their symptoms. Give the sufferer room to feel without interruption. If they’re crying, let them cry. It’ll release the pressure faster.

an individual with damage to wernicke’s area is most likely to have difficulty

Answers

Answer:

remembering the name of a person in a photograph

Explanation:

I think you're asking for fill in the blank right??

where do babies come from

Answers

Answer:

They come from the mom when a woman and a man mate.

Explanation:

Two people meet and fall in love then have a baby.

who invented you in your brain you are a smart some times how does yor brain work

Answers

so... difficult time....... and some less time

Explanation:

sometimes our brain work was superb.....but some time we the brain can't doing very well

during or after exercise, it is normal for a student-athlete to comment that his/her heart feels like it is beating out of their chest.

Answers

Answer:

uhh im not sure but no if the athletes hearts healthy it would slow down.

Explanation:

During or after exercise, it is normal for a student-athlete to comment that his/her heart feels like it is beating out of their chest. The given statement is true.

What is an athlete?

Athletes compete in one or more activities that necessitate physical strength, speed, or perseverance. Athletes can be both professionals and amateurs.

Athletes who excel are not superhuman. They simply have and use consistent technical skills that produce positive results.

They have faith in themselves and their capacity to continually improve. They set realistic goals, overwhelm themselves with the right people, and persevere in the face of adversity.

It should include calcium, iron, potassium, and fiber-rich foods. Key vitamins such as vitamin A, C, and E are also required in their diet. Try not to be tempted by unhealthy foods, which are high in empty calories.

Thus, the statement is true.

For more details regarding athlete, visit:

https://brainly.com/question/17404705

#SPJ6

The image shows part of an article from the website of the Centers for Disease Control & Prevention (CDC).A chlamydia C D C Fact Sheet that defines chlamydia and how it is spread.How can this source best be used?to support myths about chlamydiato challenge reliable information about chlamydiato confirm information found in a news articleto locate non-health, promotional sites about chlamydia

Answers

Answer: To confirm information found in a news article

Explanation: nice

Answer:

C

Explanation:

edge 2022

Teenagers who know who they are and what they believe are more likely to resist pressure.

Answers

If this is a True / False answer. Then the answer is True. If not maybe explain more of your answer when you do understand you statement. :}

Answer:

Peer

Explanation:

match A B or C to the right sentence

Binge drinking is only dangerous if you do it every day

Chewing tobacco's Fun Mary athletes use it

cigarettes are not hand to quit

A This substance can cause rotten teeth and mouth cancer

B This activity can lead to alcohol poisoning and death

C This substance is extremely addictive.​

Answers

Answer:

B(Binge drinking is only dangerous if you do it every day )

A (Chewing tobacco's Fun Mary athletes use it)

C(This substance is extremely addictive.​)

Explanation:

These are the appropriate and realistic responses/facts about the statements presented in the question

Answer:

Chewing tobacco is fun. Many athletes use it. =This substance can cause rotten teeth and mouth cancer.

Binge drinking is only dangerous if you do it every day. =This activity can lead to alcohol poisoning and death.

Cigarettes are not hard to quit.=This substance is extremely addictive.

Lifetime activities are activities that can be __________.
A.
enjoyed for many years or decades
B.
enjoyed by people within a wide age range
C.
enjoyed by people of varying athletic abilities
D.
all of the above

Answers

A, enjoyed for many years or decades

It’s a “lifetime” activity= years/decades of your life.
D all of the above because we’ll you know why
Other Questions
7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.