or
Scientists theorize that all life started with simple prokaryotic organisms. New species continue to evolve
from existing species, creating the variety of life we see today. The following diagram shows the basic
process.
fungi
(oukaryotic,
unicellular,
multicellular)
protista
(eukaryotic,
uni-or
multicellular)
eubacteria
(prokaryotic,
unicellular)
animalia
(eukaryotic
multicellular)
universal
ancestor
plantae
(eukaryotic
multicellular)
archaebacteria
(prokaryotic,
unicellular)
Based on this diagram, do you think that organisms of the same order will share a stronger evolutionary
relationship than organisms that share only the same phylum? Explain your reasoning using the results of
your investigation.

OrScientists Theorize That All Life Started With Simple Prokaryotic Organisms. New Species Continue To

Answers

Answer 1

The evolutionary relationship is stronger the more similarity. The taxonomical hierarchy's lower levels show more similarity. Thus, the organisms of the same species exhibit the greatest degree of similarity.

What is taxonomical hierarchy's?

Taxonomic hierarchy is an organizational structure used to classify or categorize living organisms.

Of course, organisms that belong to the same order will have a closer evolutionary bond than those that belong to the same phylum alone. Taxonomy groups organisms in various ways, as we all are aware. Kingdoms are the highest level of classification, followed by phyla, classes, orders, families, and species. The similarities between organisms will become more specific with each succeeding unit. In other words, when organisms are further subclassified, they share similar traits.
The order of organisms belonging to the same phylum is not required. The class, phylum, and kingdom of any two organisms from the same order, however, will always be the same.
For instance, the cockroach order Blattodea and the human order Primates. These two belong to the phylum chordata. But we are aware of the differences between cockroaches and people.
However, another member of the primate order, such as the monkey and the chimpanzee, have stronger evolutionary ties to humans and share more traits with them.
Therefore, the evolutionary relationship is stronger the more similarity. The taxonomical hierarchy's lower levels show more similarity. Thus, the organisms of the same species exhibit the greatest degree of similarity.

To learn more about taxonomical hierarchy's
https://brainly.com/question/1304906
#SPJ1


Related Questions

What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses

Answers

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

What are genes and what do they do?

A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.

What are the four primary roles of genes?

Gene functions include:

Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.

Learn more about  gene functions to visit this link

https://brainly.com/question/8334911

#SPJ4

Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

Many viruses specifically methylate protective genes, thus enhancing viral infectivity.

Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.

Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Answers

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Which of the following is true of biogeochemical cycles?

Answers

Explanation:

The carbon, oxygen, and nitrogen cycles are all biogeochemical cycles. They show the movement of elements through living and nonliving components of the Earth. Carbon, oxygen, and nitrogen, are essential components of life that pass through organisms and nonliving components, but are never used up.

I need someone to explain this

Answers

it would be carbon dioxide and oxygen. the carbon dioxide is exhaled by the human and then the plant takes it in. the plant exhales the oxygen and the human inhales it. and it continues in a circle over and over.

What would happen to the population of snakes and rabbits if hawks were removed from the ecosystem?

Answers

There would be a HUGE increase to their species, because their predator would be gone. And the snakes and rabbits pray would have a huge decrease because there would be more snakes and rabbits that would eat them.

B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas

Answers

Answer:

B) A. FALSO.  

B. VERDADERO.  

C. VERDADERO.

D. VERDADERO.

c) D. Contracción de los bronquios.

d) A. Axon, dendritas, cuerpo neuronal.

Explanation:

B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.

B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.  

C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.

D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.

c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:

D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.

d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:

A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)

Why isn't glycolysis considered a closed pathway?

Answers

Glycolysis is not considered a closed pathway because it consumes energy in the form of adenosine triphosphate (ATP) and generates energy in the form of adenosine diphosphate (ADP) and a high-energy phosphate group. Additionally, the intermediates of glycolysis, such as glucose and pyruvate, can be used in other metabolic pathways.

What is the great red spot on Jupiter
A. Hurricane
B. Thunderstorm
C. Bad Weather
D.Tornado

Answers

b.thunderstorm it has really bad winds and rain
a thunderstorm is the answer

how dors raising the temperature affect the rate of nuclear decay

HELP ASAP DYE TMRRW

Answers

Unlike chemical reaction rates, which vary with the conditions of a reaction, nuclear decay rates are constant..Raising the temperature has no effect on the rate of nuclear decay.

How does temperature impact the rate of decay?

Decomposing organisms are less active in cooler temperatures, keeping the pace of decomposition low.

How is nuclear decay influenced by temperature?

A speed of alpha, beta, & electron decays all rely on temperature & whether they are contained inside an insulating or conducting material, as demonstrated by numerous groups.

To know more about nuclear decay visit:

https://brainly.com/question/12224278

#SPJ1

Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash

Answers

Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.

Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.

Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.

Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.

Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.

Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.

Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.

Learn more about Biomass at :

https://brainly.com/question/21525417

#SPJ4

Complete question:

1.plants

2.animals

3.animal waste

4.sunlight

5.paper

6.trash

Plant seedlings were treated with a range of concentrations of coumarin, a small organic compound. After one week, seedling height was taken as a measure of plant growth. In a separate experiment, stem tissue sections were taken from newly germinated seedlings and incubated in solutions containing 14C-glucose and coumarin. After 24 hours, the quantity of radioactive label in cytoplasmic and cell wall fractions was measured. All data are shown in the table above. Which statement is supported by these results

Answers

Coumarin is found to restrict the production of a specific component found in the cell walls but not in the cytoplasm, which plays an important role in the growth of the stem. (BIOSYNTHESIS< CYTO< STEM GROWTH)

The results from the experiment suggest that coumarin treatment negatively impacts the growth of plant seedlings, as measured by seedling height. This indicates that coumarin has an inhibitory effect on stem growth.

Additionally, the experiment that measured the number of radioactive labels in cytoplasmic and cell wall fractions revealed that coumarin affects the biosynthesis of a specific component in the cell walls but not in the cytoplasm. This suggests that coumarin specifically targets the production of a component that is critical for stem growth, and that this component is found primarily in the cell walls and not in the cytoplasm.

This is further supported by the fact that the radioactive label is found in the cell wall but not in the cytoplasm, indicating that the biosynthesis of this component is taking place in the cell wall and not in the cytoplasm. Overall, these results suggest that coumarin is inhibiting the biosynthesis of a component that is critical for stem growth, specifically in the cell walls.

To learn more about germination at

https://brainly.com/question/15976369?referrer=searchResults

#SPJ4

can some one help me ill give more points if its right. ill give like 50

Answers

Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.

Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway

Answer:

Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.

Explanation:

Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.

how many gender are really there? I believe that there are two male and female but people say that there are like 50

Answers

Ehhhhh i think 2 but IM NOT REPUBLICAN

I, and certain humans, not only think or believe but KNOW that there are only two. The end.

What is the probability that two parents with the genotype AaBb will produce an offspring with the genotype AaBb?

Answers

The probability of parents with the AaBb genotype producing offspring with the genotype AaBb is 4/16. Thus the correct answer is (b) 4/16.

The Punnett square method is used to forecast the prospective offspring from a certain cross based on the gametes of the parents. The parents carefully create the gametes that are arranged in a checkerboard pattern so they can understand all the potential children that can be generated. The likelihood of each prospective offspring can be determined using the checkerboard method. In the cross, there are four gametes produced by each of the two dihybrid parents. As a result, the hybrid has the capacity to produce a total of 16 offspring. Out of the 16 possible combinations, only four types of offspring can have the AaBb genotype.

Parents: AaBb*AaBb

Genotypes: AB   Ab    aB   ab *  AB    Ab   aB   ab

Offspring:   ABAB    ABAb   ABaB   ABab   AbAB   AbAb  AbaB  Abab  aBAB   aBAb   aBaB   aBab   abAB  abAb  abaB  abab

Percentage: AaBb: 4/16

The complete question is:

What is the probability of an AaBb offspring when you cross AaBb x AaBb parents?

a. 1/2

b. 4/16

c. 1/8

d. 1/32

e. 1/4

To learn more about cross between parent genotypes please click on the given link: https://brainly.com/question/26601444

#SPJ4

How has the world population changed in the last 200 years?

Answers

The world population has greatly increased in the last 200 years. Hope this helps :-)
the world population has increased and more humans are being born every year

A sea otter is considered very important in
maintaining his ecosystem and food web.
Changes with him will affect the ecosystem
dramatically. A species such as this is called
a(n).
A. keystone species
B. VIP
C. ecosystem king

Answers

The answer would be Key stone species

A DNA s
equence has mutated from

AAG G
CA TTC
-
t
o the sequence of

AAG GCT ATT C
-
. This mutation is an
example of a/an ___________________?
a.
Frameshift mutation
b.
Point
mutation
c.
Triple shift mutation
d.
Chromosomal
mutation

Answers

Answer:

Explanation:

The mutation is from AAG GCA TTC to AAG GCT ATTC

So there is a frameshift with an insertion of a T

Answer is a Frameshift mutation.

Answer:

Explanation:

its an example of single insertion leading to a frameshift mutation

The definition of biological evolution encompasses

Answers

Answer:

Biological evolution, simply put, is descent with modification. This definition encompasses small-scale evolution (changes in gene frequency in a population from one generation to the next) and large-scale evolution (the descent of different species from a common ancestor over many generations).

Explanation:

PBS Evolution: Great Transformations

1. If the world’s history were compressed into one hour, how long have humans been here?

Microbes. Single-celled organisms


2. How long ago did mammals first appear on earth?

Mammals first appeared about 200 million years ago

3. What type of animal did the skull that Dr. Gingrich discovered resemble?

Dr. Gingrich discovered resembled a whale

4. What did "Whale Valley" used to be?

Whale valley is a


5. What unusual feature did they find at the end of the early tetrapods’ limbs?


6. How long ago did animals first appear on Earth?


7. When the mouse "eyeless" gene was implanted into the fruit flies, what happened?


8. How would walking on two legs be an advantage?


9. What modifications does the human skeleton have?

Humans has the same transformation as other animals even though humans are special.


10. Summary/reflection:

Answers

Given that whales and other mammals resembled other mammals in terms of their skulls and other sculptures, based on the fossil evidence, humans have undergone evolutionary transitions.

The transition from land animals to whales is one of the most well-known instances of a supposed change cited by the evolution contingency in the opening of the program. The fossils of Pakicetus, Ambulocetus, Rhodocetus, Dorontid, and Basilosaurus show that this transition can be explained. Pakicetus only has a small portion of its cranium to display, as opposed to a whole transitional fossil.

The program portrays Ambulocetus as a fully preserved fossil of an aquatic mammal with legs, yet this is a stretch of the fact because the animal's skeleton was actually discovered to be extremely fragmented. Rhodocetus is solely represented in the series by a skull.

To know more about evolution, refer to the following link:

https://brainly.com/question/27748371

#SPJ4

what is the ratio of 15 minutes to 2 hours​

Answers

Answer:

15mins : 2 hrs

15 mins : 120 mins

1 : 8

Answer:

1:8

Explanation:

Convert 2 hours to minutes:

60*2 = 120 minutes

15/120 = 1:8

The occurrence of transitional fossils supports the idea that (select all that apply)Group of answer choices extinct and living forms are related.these are ancestors of living species.change occurs in species over time.

Answers

The occurrence of transitional fossils supports the idea that - extinct and living forms are related, these are ancestors of living species, change occurs in species over time.

A transitional fossil is that  fossilized remains of a life form which exhibits traits common to both an ancestral group and its derived descendant group which is living at present. The descendant group is sharply differentiated by gross anatomy and mode of living from the ancestral group.

These fossils show that taxonomic divisions are human made that have been superimposed on the continuum of variation. Because of the incompleteness and unavailability of the fossil record, there is usually no way to know exactly how close a transitional fossil is to the point of divergence if evolution of that particular species. Therefore, it cannot be assumed that transitional fossils are direct ancestors of more recent groups, though they are frequently used as models for such ancestors.

For further learning about transitional fossils ,follow the link:

https://brainly.com/question/7156308

#SPJ4

What was the most significant conclusion that Mendel?

Answers

The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.

The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.

Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.

The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.

Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.

For more information on Mendel's experiment , visit :

https://brainly.com/question/30097040

#SPJ4

Complete question :

What was the most significant conclusion that Mendel drew from his experiments?

A There is considerable genetic variation in garden pea

B Traits are inherited in discrete units one from each parent

C Genes are composed of DNA

D Recessive genes occur as frequently as dominant ones.

What implications could this have for this species of slug from an evolutionary standpoint? What potential advantages or disadvantages might this mutation have?

Answers

Positive mutations are essential for evolution to occur. They raise a living thing's chances of surviving or procreating. Deadly mutations can give rise to cancer or genetic diseases.

Are mutations typically detrimental?

While most mutations are beneficial, some can also be dangerous. A dangerous mutation might cause a genetic illness or a cancerous condition. Chromosome-level mutations are still another type. Chromosomes, which are little, threadlike organelles present in the cell nucleus, carry genes.

Why do mutations cause issues?

A variation can make a protein malfunction or not be created at all by altering the gene's instructions for producing it. A variation can impair normal development or result in a disease when it changes a protein that is essential to the organism.

To know more about mutations visit:

https://brainly.com/question/17130462

#SPJ1

How does hypertension cause stroke?

Answers

In hypertension, The arteries that carry oxygen and blood to the brain can burst or become blocked by high blood pressure, resulting in a stroke.

There are many ways that high blood pressure can harm your health. It has the potential to seriously harm vital organs like your eyes, brain, kidneys, and heart. Your arteries may become less elastic as a result of high blood pressure, reducing the flow of blood and oxygen to your heart and resulting in heart disease. A stroke can result in severe impairments of speech, movement, and other fundamental activities. You can also die from a stroke.

Know more about hypertension here: https://brainly.com/question/29799896

#SPJ4

Why are vestigial structures not removed by natural selection?

Answers

Structures that have no apparent function and appear to be residual parts from a past ancestor are called vestigial structures. Examples of vestigial structures include the human appendix, the pelvic bone of a snake, and the wings of flightless birds.

How do glands of the endocrine system help your body maintain homeostasis?

Answers

The glands of the endocrine system secrete hormones into the bloodstream to maintain homeostasis and regulate metabolism. The hypothalamus and the pituitary gland are the command and control centers, directing hormones to other glands and throughout the body.

8. The table below shows the number of generations required to produce white
butterflies through natural selection Calculate the mean, or average, number
of generations it takes to produce white butterflies.

Answers

Answer:

mean is  44.8

median is 36

Range is 32

Explanation:

hope it helps  

stay safe love u

btw can i get brainliest

Biologists look at how organisms are related and when they first appeared on Earth. Which of the following is true about the organisms that live on Earth today?

A. All organisms that have ever lived on Earth can still be found alive today.

B. Some of the organisms alive today have been around for 4.6 billion years.

C. The organisms alive today are the same as the ones found in fossils.

D. The organisms alive today evolved from organisms that previously lived on Earth.

Answers

Answer:

the organisms alive today evolved from organisms that previously lived on Earth.

Explanation:

nuneeedadoll on IG

The organisms that live on Earth today evolved from organisms that previously lived on Earth.

What is pre existing organism?

The focus of biogenesis states that all living organisms arise from a pre-existing living organism. The theory of biogenesis is given by Louis Pasteur.

The theory said that life comes from pre-existing life, by means of reproduction. Living beings do not arise from non-living things.

Thus, option "D" is correct,  organisms arise from a pre-existing living organism.

To learn more about organisms click here:

https://brainly.com/question/12825206

What happens in insertion mutation?

Answers

An insertion mutation changes the DNA sequence by adding one or more nucleotides to the gene.

An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and frameshift mutations.

Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.

To learn more about mutation , here

brainly.com/question/17130462

#SPJ4

Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.

Answers

Answer:

Yes they are wrong

Explanation:

I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.

Other Questions
Mount Rushmore is a huge carving in the side of a stone cliff. The carving is of four U.S. presidents. The presidents are George Washington, Thomas Jefferson, Theodore Roosevelt, and Abraham Lincoln. The main idea of this story is when both the inside rearview mirror and the outside rearview mirrors are adjutsed properly, the right blind spot and the smaller blind spot to the left will Only answer if youre sure :) need full equation. Will give Brainly! 15. Which of the following is the best way to pick a topic for an academic essay?OA. Taking a topic directly from an essay that's already been writtenO B. Starting to write the essay and finding a topic as you proceedOC. Asking a friend what your essay should be aboutO D. Prewriting activities like brainstorming or research What is the main advantage that a true experiment has in relation to all other methods used in psychological research Show Your Work gerry spends $1.25 each day on lunch at school. every friday, she buys an extra snack for $0.55. how much money will she spends in two weeks Three siblings are born on the same date in consecutive years.The sum of their ages is 42. What is the age of the oldest sibling?A. 13B. 14C. 15D. 16 ?como se dice "to say goodbye" en espaol A. despedirseB. subirse C. bajarse D. esperar A circle is the set of all points that are the same distance from one given point. Find an example that contradicts this definition. How would you change the definition to make it more accurate? HELPPPPPP PLEASEeeeeeeeeeeeeee What is the final set of instructions that the virus gives an infected cell so that more viral particles may be released into the body HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAPHELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP Two exponential functions, f and g, are shown in the figure below, where g is a transformation of f.19.4-24xWhich of the equations given below describes the transformation of f?OA. g(x) = f(x) - 4OB.g(x) = 4f(x)O c.g(x) = f(x) + 4OD.g(x) = -4f(x)E What is plotting a point in the plane? Which word is a synonym of transaction?1. conclusion2. production3. exchange4. reversal Solve the problem.2) A theatre sells two types of tickets to their plays; children's tickets and adult tickets. For today'sperformance they have sold a total of 914 tickets. Also, they have sold 80 more adult tickets thanchildren's tickets. How many children's tickets have they sold?A) 421B) 419C) 413D) 417 What are the three types of document classification? PLEASE HELP NOW!!!! WILL GIVE BRAINLIEST!!! Which of the following individuals was the manager of the Homestead Works during the Homestead Strike and nearly lost his life in an assassination attempt what are the application area of the computer?explain in brief.