PLEASE HELP ASAPPP!!!!!

PLEASE HELP ASAPPP!!!!!

Answers

Answer 1
For part 1.

1 goes with A
2 goes with D
3 goes with E
4 goes with C
5 goes with F

For the second part I’m honestly not sure how to do it.

Related Questions

Evaluate 2+x-2x7 for x=7

Answers

The answer is -5. Hope it helped!

can someone help with this question please

Answers

Answer:

3

Step-by-step explanation:

Always include the steps and/or background required to get to the final answer. Let’s help other people understand and solve future problems on their own.

3y = x - 12
Y= 1/3X -4
parallel, perpendicular or neither

Answers

Answer:

PARALLEL

Step-by-step explanation:

The second equation, y = (1/3)x - 4, has already been solved for y.  To compare the slopes easily, we need now to solve the first equation for y, obtaining y = (1/3)x - 4.

We see that these two lines have the same slope, m = 1/3, and thus conclude that these lines are PARALLEL.

Please help me with this my math isn't the best

Answers

From vertical angles and corresponding angles, I could figure out that that angle would equal 100 degrees. So we just equal the equation to 100 and solve. X=17

Mrs. Chiu checks 30 problems in 2 minutes. How many problems can Mrs. Chiu check in 68 minutes?

Answers

1,020. Divide 30 by two get the amount she can do in one minute, you get 15. Then multiply that by 68, and you get 1,020. Hope this helps :)

What is the value of W in a exterior angle theorem

Answers

Answer:

26

Step-by-step explanation:

The sum of two interior angles in a triangle is equal to an exterior angle that is supplementary to the third interior angle.

so:

30 + 2w - 8 = w + 48

22 + 2w = w + 48 export like terms to the same side of the equation

2w - w = 48 - 22 subtract

w = 26

help me please i need it

Answers

Answer:C

Step-by-step explanation:

According to the graph how much money did you start with in your savings? b. How much money will you have after 5 weeks of saving? c. Fill in the table at the right and extrapolate for weeks 6, 7 and 8.

Answers

Answer:

A

Step-by-step explanation:

A soccer team is having a car wash. The team spent $50 on supplies. They earned $300, including tips. The team's profit is the amount the team made after paying for supplies. Use a sum of integers to find the team's profit. The team's profit was $​

Answers

Answer:the answer is $ f(x) = 3x + 50

f(22) = 3(22) + 50

f(22) = 66 + 50

f(22) = 116

So, he will make $116.

As an ordered pair, the solution is (22, 116).Step-by-step explanation:

Money earned =$300Money spent on supllies=$50

Profit =Money left after supplies

[tex]\\ \sf\longmapsto Profit=300-50[/tex]

[tex]\\ \sf\longmapsto Profit=\$250[/tex]

Forty-five people volunteered, but 200% of that number are needed. How
many people are needed?

Answers

45times2=90
That’s the answer

Let C be the event that a randomly chosen person went to college. Let J be the event that a randomly chosen person has a job. Identify the answer which expresses the following with correct notation: Given that the person went to college, the probability that a randomly chosen person has a job.

Answers

The probability of event J, followed by event C is occurred is P( J | C)

What is probability?

The ratio of good outcomes to all possible outcomes of an event is known as the probability. The number of positive results for an experiment with 'n' outcomes can be represented by the symbol x. The probability of an occurrence may be calculated using the following formula.

Probability(Event) = Positive Results/Total Results = x/n

Experiment: A trial or procedure carried out to generate a result is referred to as an experiment.Sample Space: A sample space is the collection of all potential results of an experiment. Tossing a coin, for instance, has two possible outcomes: head or tail.Favorable Consequence: An occurrence is deemed to have generated the desired outcome or an anticipated event if it did so.Trial: To conduct a trial is to conduct a random experiment.

The given case is case of Conditional Probability.

As, the probability of random chosen person has a job 'j' followed by the person went to the college 'c'

The, the probability of event J, followed by event C is occurred is

= P( J | C)

Learn more about probability here:

https://brainly.com/question/11234923

#SPJ2

How many solutions are there to the equation below?
7(x + 2) = 7x-10
A. Infinitely many
В. 0
C. 1

Answers

B, they don’t seem to be equal

1. One skater paid $108.00 for
36 fancy jewels to sew on her
costume. What did each
jewel cost?

Answers

Answer:

each jewel was 3 $

Step-by-step explanation:

divide 108.00/36= 3

Step-by-step explanation:

$3 for each jewel.

9. A nonstop bus ride from the bus station in Atlantic City, New Jersey, to the bus station in Albany, New York,
took 6 hours. If the average speed of the bus was 21 meters per second, what is the distance between the two
bus stations, to the nearest kilometer?
a.756 kilometers
b. 126 kilometers
c. 454 kilometers
d. 350 kilometers

Answers

Answer:

C

Step-by-step explanation:

EASY IVE DONE IT

Using conversion of units and the relationship between velocity, distance and time, it is found that the distance between the two stations is of:

c. 454 kilometers

Velocity is distance divided by time, that is:

[tex]v = \frac{d}{t}[/tex]

In this problem:

Time of 6 hours, hence [tex]t = 6[/tex].Velocity of 21 m/s. To convert from m/s to km/h, we multiply by 3.6, hence [tex]v = 21(3.6) = 75.6[/tex]

Then, solving for the distance:

[tex]v = \frac{d}{t}[/tex]

[tex]75.6 = \frac{d}{6}[/tex]

[tex]d = 6(75.6)[/tex]

[tex]d = 453.6[/tex

Rounding up, 454 km, option c.

A similar problem is given at https://brainly.com/question/24316569

help!!

A bank building in the downtown area stands 42 feet tall. if the high rise office building is 102 times as tall as the bank building, how tall is the office building​

Answers

Answer:

4284 feet tall

Step-by-step explanation:

42*102=4284 feet

3 1/2 divided by 50 1/4?

Answers

14/201, hope that helps
The correct answer is 14/201

I need help, I can’t find the answer.

Answers

Answer:

to get rid of the fraction multiply both sides by six

Answer:

multiply both sides by 6

Step-by-step explanation:

you won't add 2 until you have a whole number, not a fraction.

You don't need to change the direction

and you aren't supposed to change the =, >, <, or any of those signs ever, until you get to where you are multiplying or dividing by a negative number

need help with math
702÷2.4​

Answers

Answer:

Step-by-step explanation:

please help me

no random links pls

Answers

Answer:

A

Step-by-step explanation:

aomsmowemrongmroegmfd;

what is 7019 - 1135 plezzzzzz

Answers

Answer:

The answer to 7019 - 1135 is 5884

If we know a quadratic function has a zero at x=-1 and vertex at (1,4) do we have enough information to find a formula for this function? If your answer is yes, find it; if not, give your reasons.

Answers

If not not if yes yes ofc ofc well then yes yes I’m getting points or whatever anyassh

What is the solution to 8x minus 3(2x minus 4) = 3(x minus 6)

Answers

Answer:

x = 30.

Step-by-step explanation:

8x - 3(2x - 4) = 3(x - 6)

8x - 3*2x + - 3*-4 = 3*x + 3 * -6

8x - 6x + 12 = 3x - 18

2x + 12 = 3x - 18

2x - 3x  + 12 = 3x - 3x - 18

-x + 12 = -18

-x + 12 - 12 = -18 - 12

-x = -33

-x/-1 = -30/-1

x = 30.

Answer:

[tex]x=30[/tex]

Step-by-step explanation:

[tex]8x-3\left(2x-4\right)=3\left(x-6\right)[/tex]

First, we will expand [tex]-3\left(2x-4\right)[/tex] by applying the distributive property:

[tex]-3\times \:2x-\left(-3\right)\times \:4[/tex]

** [tex]-\left(-a\right)=a[/tex]

[tex]-6x+12[/tex]

[tex]8x-6x+12=3\left(x-6\right)[/tex]

Expand, [tex]3\left(x-6\right):[/tex]

[tex]3x-3\times \:6[/tex]

[tex]3x-18[/tex]

[tex]2x+12=3x-18[/tex]

Subtract 12 from both sides:

[tex]2x+12-12=3x-18-12[/tex]

[tex]2x=3x-30[/tex]

Subtract 3x from both sides:

[tex]2x-3x=3x-30-3x[/tex]

[tex]-x=-30[/tex]

Divide both sides by -1:

[tex]\frac{-x}{-1}=\frac{-30}{-1}[/tex]

[tex]x=30[/tex]

________________________

5/8 multiplied by 3/4 + 1/2

Answers

Answer:

31/32 or 0.96875

Step-by-step explanation:

first you muliply 5/8 by 3/4 then the answer add it to 1/2

1/4 x 1/8 and simplify

Answers

Answer:

[tex] \frac{1}{4} \times \frac{1}{8} = \frac{1}{32} [/tex]

-3b+7b+5= -19

I believe the answer is -6

Answers

Answer:

B = -6

Step-by-step explanation:

so yes, you're correct.

What is the approximate value of 2–√, to the nearest whole number?

Answers

[tex]2 - \sqrt{1} \\ = 2 - 1 \\ = 1[/tex]

Will mark brainliest !!!
Solve for x.
23=1000

Answers

Answer:

x=10

Step-by-step explanation:

10x10x10 =1000

10^3=1000

Answer:

x = 10

Step-by-step explanation:

x cubed is 1000

so x times x times x equals 1000

10 times 10 times 10 = 1000

10^3=1000

State the domain and any values that are excluded from the domain of the function.

f(x) = 2x-5/x-4
I give Brainliest!

Answers

Answer:

see explanation

Step-by-step explanation:

f(x) = [tex]\frac{2x-5}{x-4}[/tex]

The denominator cannot equal zero as this would make f(x) undefined.

Equating the denominator to zero and solving gives the value that x cannot be

x - 4 = 0 ⇒ x = 4 ← excluded value

Domain is x ∈ R , x ≠ 4

pls help asap asap!!!


need an answer now!

Answers

[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]

The equation f(x) = g(x) has : (in box 1)

[tex]1[/tex]

Box - 2 :

[tex]x = 1[/tex]

(x - 3 ) ( 6x -2)

help plz

Answers

6x² - 20x + 6

Step-by-step explanation:

[tex]\begin{aligned}\tt\left(x-3\right)\left(6x-2\right)&=\tt 6x^2-2x-18x+6\\&=\tt 6x^2 -20x+6\end{aligned}[/tex]

Answer:

6x^2 - 20x + 6

Step-by-step explanation:

(x - 3) (6x - 2)

6x^2 - 18x - 2x + 6

6x^2 - 20x + 6

Other Questions
The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio escride otra vez este texto pero con los verbos en pretrito perfectoMe levanto (1) a las ocho, preparo (2) un caf y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)cuarenta minutos en llegar a la universidad; en el autobs leo (6); el autobs va (7) lleno de gente y es (8)muy incmodo.Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy(11) cansada. Despus, como (12) con mi amiga Helena y ms tarde tomamos (13) un caf en la cafeterialde la facultad. Vamos (14)........ a la biblioteca y estudiamos (15)..un rato.Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.Hablo (19) por telfono con mi novio y me acuesto (21) a las 24.00. Question poIn an auditorium, a charity show is conducted in order to raise at least $3,000. The auditorium canaccommodate up to 180 spectators. Tickets cost $12 for students and $20 for adults. Identify the system ofinequalities and the corresponding graph that determine whether the charity will reach its goal. Is each ion stable? Explain. Pleaaaaaaseeee10 pointsIn the playing card deck below what is the chance of pulling 4 face cards without replacing the cards in between pulls? Answer in decimal form rounded to the 6th digit after thedecimal anybody help? reporting fake answers tysm!! The match was __________ live all over the world why weren't Spanish explorations successful in North America many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high proportion of adenines and thymines? someone help me please S + 6 HNO3 --> H2SO4 + 6 NO2 + 2 H2OIn the above equation how many moles of water can be made when 28 moles of HNO3 are consumed?AND 2 NH3 + 3 CuO g 3 Cu + N2 + 3 H2OIn the above equation how many moles of water can be made when 76 moles of NH3 are consumed?