Please help with this. Evan reads that some minerals can come from organic processes. Where does the energy ultimately come from that is needed for organic materials to be made?

Answers

Answer 1

Answer: Energy from the Sun fuels life on Earth

Sunlight allows plants, algae and cyanobacteria to use photosynthesis to convert carbon dioxide and water into organic compounds like carbohydrates. This process is the fundamental source of organic material in the biosphere.

Answer 2

Answer:

sun

Explanation:


Related Questions

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

Question 2
In this part of the experiment, you’ll prepare and test three milk solutions: milk and water, milk and lactase enzyme, and milk and heated lactase enzyme.

Prepare

Use masking tape to label the three beakers: “milk,” “lactase solution,” and “heated lactase solution.”
Measure 60 milliliters of milk in the graduated cylinder (or ¼ cup of in a measuring cup. Pour it into the beaker labeled “milk.”
In the beaker labeled “lactase solution,” add one lactase tablet and 100 milliliters (or 1/2 cup) of cool or room-temperature water. Use the stirrer to dissolve the lactase tablet in the water.
Add 100 milliliters (or 1/2 cup) of milk to the microwaveable container. Dissolve a lactase pill in the container. Put the solution in the microwave and heat it to boiling (about 2 minutes). Use oven mitts to remove the container. Pour the heated lactase solution into the beaker labeled “heated lactase solution” and let it cool.
Stay safe! Be careful while handling the boiled mixture to avoid spilling it on your hands.

Test

While you’re waiting for the lactase solution to cool, read the directions on the test strips. The test strips in the Edmentum lab kit will react to glucose within a few seconds. If you use different strips, the reaction time may vary. Now follow these steps to test the solutions. Record your data in the answer space.

Milk and water solution: Fill the first test tube one fourth full of milk. Fill the small graduated cylinder with water and gently add it to the milk in the test tube until the test tube is half full. Use the stirrer to thoroughly mix the solution. Then insert the test strip for 10 to 20 seconds. Look at the test strip, and record whether it changed color. Wash the stirrer.
Milk and lactase enzyme solution: Fill the second test tube one fourth with milk and one fourth with the lactase solution. Use the stirrer to thoroughly mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color. Wash the stirrer.
Milk and heated lactase enzyme solution: Fill the third test tube with one fourth milk and one fourth of the heated lactase solution. Use the stirrer to mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color.
Note: Keep the lactase and heated lactase solutions for the next part of the experiment.

Wash the “milk” beaker, the test tubes, and the stirrer. If you used paper cups as an alternative, throw them away.

Answers

Answer:

The bacterium should stop production of lactase.

Explanation:

This is because the E. coli bacteria can degrade lactose, but lactose is not preferred as source of fuel or energy to glucose. If glucose is present, E. coli would preferably employ it over lactose as Glucose needs little process and minimal energy to degrade when compared to lactose. Although, if lactose is the major sugar that is present, the E. coli will have no option than to employ it as it's source of fuel or energy. The formation of lactase enzyme utilizes energy, which cannot be utilised in the presence of high level glucose.

This appears to be a set of instructions for a lab experiment involving testing different milk solutions with lactase enzyme.

What is lactase enzyme?

Lactase is an enzyme that breaks down lactose, a sugar found in milk and dairy products, into glucose and galactose. People who are lactose intolerant have insufficient levels of lactase, which can lead to symptoms such as bloating, gas, and diarrhea when they consume dairy products.

The experiment involves preparing three different solutions (milk and water, milk and lactase enzyme, and milk and heated lactase enzyme) and then testing each solution with a test strip to see if it changes color, indicating the presence of glucose.

The instructions also include safety precautions, such as being careful while handling the heated lactase solution. Finally, the instructions remind the reader to wash all equipment used in the experiment.

Some people may have lactose intolerance, which means that they do not produce enough lactase to break down lactose in their bodies, resulting in discomfort and digestive problems.

Learn more about Lactase at:

https://brainly.com/question/27612608

#SPJ3

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

Elevated fibrinogen levels result in a(n) ___________, which increases the risk of a coronary or cerbrovascular incident.

Answers

Answer:

hypercoagulable state

Explanation:

Elevated fibrinogen levels result in hypercoagulable state , which increases the risk of a coronary or cerbrovascular incident.

A hypercoagulable state in medicine refers to a condition in which there is an abnormal increase in the tendency toward the clotting of blood also known as blood coagulation.

When fibrinogen levels are high, there is an increase in clot stiffness, increase in resistance of the clot to fibrinolysis as well as an increased blood viscosity.

Atoms in covalent bonds _____ their electrons.

Answers

um i think it’s share but i’m not sure

Answer:

share

Explanation:

covalent bonds share electrons

ionic bonds transfer electrons

1. Chantelle was given a sample of breakfast cereal to test for carbohydrates. (a) First, she decided to test the sample for glucose. Describe the test she should carry out and the results she might expect if glucose is present.

Answers

Answer:

The correct answer is - Benedict's solution for the test for glucose in food.

Explanation:

Benedict's solution is a test that is used to check if there is a presence of glucose in a food sample or not. It is possible due to the oxidation of the aldehyde present in the glucose turns to carboxylic acid in presence of the clear blue solution of sodium and copper salts or benedict's solution.

In presence of Benedict's solution the color of the sample turns yellow to orange with an increase in heat, however, the initial color of the solution is aqua blue.

Thus, the correct answer is - Benedict's solution for the test for glucose in food.

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

I NEED HELP ASAP!!!! BRAINLIEST AND 50 POINTS!!!! Cycles in nature involve the recycling of matter. Which of the following processes is a key part of the water (hydrological) cycle? a
transpiration
b
combustion
c
photosynthesis
d
decomposition

Answers

Cycles in nature involve the recycling of matter the following processes is a key part of the water (hydrological) cycle the photosynthesis.

What is the importance of water cycle?

The water cycle is a critical ecological procedure that continues the share of water in the earth's ecosystem and ecosystems. The water cycle entails the cyclic motion of water from water our bodies and groundwater into the ecosystem via plants, which play a position in this cycle through photosynthesis and transpiration.

Photosynthesis in concerned withinside the water cycle as it helps transpiration and makes use of water as a reactant.

Read more about the hydrological:

https://brainly.com/question/5187046

#SPJ1

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

2. A unique characteristic of the banyan tree is that roots grow down from its
branches into the ground. The tree can appear to have several trunks. What
advantage does this root characteristic give the banyan tree over other trees?
A. The roots provide shelter for ground-dwelling animals, which carry nutrients
to the tree.
B. The banyan can grow near the equator, because aboveground roots are
more protected from the sun.
C. The banyan can only grow in humid climates, because aboveground roots
are more likely to dry out and die during droughts.
D. The banyan can grow in areas prone to hurricanes and typhoons because
the roots make the tree more stable in high winds.

Answers

Answer:

D. The banyan can grow in areas prone to hurricanes and typhoons because

the roots make the tree more stable in high winds.

Explanation:

According to this question, banyan tree posseses a unique characteristic in which roots grow down from its branches into the ground making the tree appear to have several trunks. This type of root is called STILT OR PROP roots.

The major function of this stilt roots is to provide additional support for the plant during adverse conditions. Hence, a major advantage that this root characteristic give the banyan tree over other trees is that it confers resilience upon the banyan tree, making it able to grow in areas prone to hurricanes and typhoons because the roots make the tree more stable in high winds.

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

Answer asap

In what stage are humans learning essential skills like hunting, cooking and animal identification

Adult

Childhood

Adolescence

Infancy

Answers

Answer:

Adolescence

Explanation:

Given that infancy, age is the age of little children from the point of birth to about four years

Hence, this cannot be an answer.

Childhood is wrong because the childhood age is the age of 2 to 13. At such a tender age, one cannot go hunting due to fear of wild animals or have the capacity to learn to cook different food

Adult is also not correct because Adult age lies between 21 to 40 when middle age comes by. At this stage, one is expected to have at least basic skills to survive.

Therefore the correct answer is Adolescence. This is the age of 10 to 19. It is the last stage before Adulthood where one has to hone his basic and surviving skills. At this point, it is believed one has full mental capacity.

Answer:

Its Childhood don't listen to the other guy

Explanation:

I just got it right on my quiz

Which defensive adaptation would best help a plant survive in an environment with leaf-eating animals?

A.
large fruits

B.
thick stems

C.
sharp thorns

D. colorful flowers

Answers

Answer:

C.  sharp thorns

Explanation:

The plants stand still, are not very physically active, and seem to be on the menu of many animals. Precisely because they cannot win at the first sign of danger, one has developed other ways in which they can defend themselves from annoying and dangerous animals.

Some have developed long thorns that repel attackers. Some have poisons that are very strong and because of which animals do not think of trying to eat that plant, but the defense of some plants seems to be well thought out and ready for all forms of attack.

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Which fish species are the least tolerant of water pollution? Which fish species are most tolerant. how would you arrive at your conclusion?
Fishes used;
Bass
Carp
Gar
Catfish
Trout​

Answers

The fish that is less tolerant to water pollution is trout hope this helps :D

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

Other Questions
__________ often separated the Greek city-states from each other.A.WallsB.LakesC.DesertsD.MountainsPlease select the best answer from the choices provided While New York City's population is more than twice as large as the 2nd largest American city, Los Angeles, which statement best explains why the United States does NOT have a primate city? This is the second part of that question. What's the answer to this Direct exporting refers to Multiple Choice offering the right to a trademark, patent, trade secret, or similarly valued items of intellectual property in return for a royalty or fee. contracting with a foreign firm to manufacture products according to certain specifications. a foreign country and a local firm investing together to create a local business. using additional parties when a firm sells its domestically produced goods in another country. a firm selling its domestically produced goods in a foreign country without intermediaries. Training in how to handle hazards such as utilities and Hazardous Materials (HazMat) should be provided to responders by the: A ball is thrown straight up in the air. For which situations are both the instantaneous velocity and the acceleration zero?a. on the way up b. at the top of its flight path c. on the way down d. halfway up and halfway down e. none of the above I shared with her my boring life-Missing fun and lacking friends.She said, "The effort that you make-On that all happiness depends."How does the author's word choice here affect the tone of the poem? A. It conveys a mocking tone because the speaker is very condescending. B. It conveys a confusion because the speaker doesn't want to change. C. It conveys a sarcastic tone because the speaker is very angry.D. It conveys a gloomy tone because the speaker is unhappy. which description shows copper at rtp? Kelsey solved the following equation 7x-1/2(8x+2)=6 a 100kg car travels at 2m/s. what is the momentum in kg Employers favor _____ because they are often capable of producing outcomes that surpass the efforts of individuals. temporary workers unions teams all of the above Explain what is the Policy of Containment, and its four goals. How do I solve -7x+9=51 Describe how the graph is related to the graph of y = lxl. 1) a) Factorize: G(x) = (x+5)2 3x(x+5).b) Solve G(x) = 0.2) In the adjacent figure ABCD is a square:a) Express the area of the square and the areaof triangle AEB in terms of x.b) Calculate x so that the area of the square is equalto 6 times the area of triangle AEB. What is the main conflict in the story?A. To survive, the men build snow houses using their snowshoes and knives.B. The ice floe begins to float away, leaving the men strandedC. The men do not realize that the wind is blowing toward the north.D. The watchman on King's Island welcomes the men on the island. what Should be added To -6(-p-1) to get 3p+5p+6p-2? PLEASE HELP ITS TIMED ABC Corporation is one of the largest energy companies in the UnitedStates, with over $50 million in publicly traded shares. The corporation's unusual accounting practices have disguised the fact that the company has accumulated significant losses over the past five years, making it appear far more profitable than it is. The CEO of ABC Corporation has decided to continue misleading investors by hiding its mounting debt in order to support the company's current market valuation.How would a deontologist evaluate this decision?a. ABC Corporation is acting unethically because it has certain rights as a corporation, and therefore has a corresponding duty to consider the public good.b. ABC Corporation is acting unethically because the results of its dishonesty are likely to be negative for its employees, for its shareholders, and for society as a whole.c. ABC Corporation is acting unethically because it sees the investors' interests as unequal to the interests of the CEO and the corporation.d. ABC Corporation is acting unethically because it is not striving for truthfulness or high-mindedness.Select the example where the court has established personal jurisdiction over the defendant.a. Frank, an accountant, is suing a client for unpaid bills. The client is located in Mississippi, and Frank lives and works in Virginia. Frank initiates his lawsuit in his home state, because he knows many of the state judges.b. Miguel is being sued by an acquaintance of his over unpaid debts. Both Miguel and the plaintiff are residents of Colorado. Miguel has not been personally visited by a process server with a summons to appear in court, but he did receive one in the mail at his home.c. Drew is being sued by a man who claims that Drew committed slander by speaking ill of him. Drew lives in Oregon, but the man is from Texas. Drew has received a summons ordering him to appear in court in Texas to respond to the complaint.d. Aisha, a resident of New York, is visited by a process officer at her workplace in New York City and delivered a summons to appear in court in Maryland. The lawsuit against her relates to property damage that occurred in a home she rented in New Jersey, which is owned by a woman from Maryland. what is equilibriumPlease answer And if help needed I am here to help anyone Steam Workshop Downloader