Predict the products of the following reaction: Zn(ClO₃)₂ (aq) + K₃PO₄ (aq)

Answers

Answer 1

The products : Zn₃(PO₄)₂ (s) + KClO₃ (aq)

Further explanation

Given

reaction: Zn(ClO₃)₂ (aq) + K₃PO₄ (aq)

Required

The products

Solution

Double-Replacement reactions :  an ion exchange between two ion compounds in the reactant to form two new ion compounds in the product

General formula :

AB + CD ⇒ AD + CB

One of the characteristics of the double replacement reaction is the presence of precipitated compounds

Zn(ClO₃)₂ (aq) + K₃PO₄ (aq) ⇒ Zn₃(PO₄)₂ (s) + KClO₃ (aq)

Zn₃(PO₄)₂ (s)⇒ precipitated compounds, so that this reaction can occur


Related Questions

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons

Answers

He announced that cathode rays consisted of a steam of Electrons.

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

F
19.00
Fluorine
Using the information on the figure above, report the atomic number and atomic mass of fluorine.

Answers

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

what is observed when an iron bar is dipped into a solution of silver nitrate​

Answers

Answer:

I think it will start to have a greenish color and get lighter

Explanation:

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.

Can someone answer these two separate questions pls ill give brainliest

Answers

The average speed

3. 89.7 m/min

4. 6.13 ft/min

Further explanation

Given

3. 1076 m in 12 min

4. 92 ft in 15 min

Required

average speed

Solution

3.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{1076~m}{12~min}[/tex]

This is my answer = 89.7 m/min

4.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{92~ft}{15~min}[/tex]

This is my answer = 6.13 ft/min

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Indicate which one of the two species is larger
A. Mg2+ or Ca2+

Answers

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.

When iso-propanol burns in oxygen, carbon dioxide and water are produced

Answers

Explanation:

When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

2. Explain how to determine the wavelength of a wave.
Type your answer here.
I

Answers

Answer:

Hope it helps:)

Explanation:

Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...

To find the wavelength of a wave;

The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

Which one is correct? Please hurry, the audio is just reading the question!

Answers

I think it is D! Hope this helps

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g

Answers

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

What is molar mass ?

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop


Na2SO3 + S -------> Na2S2O3


Answers

Answer:

Synthesis

Explanation:

A+B=C

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

plzz help this is timed! true or false/Continental air masses are cold. Maritime air masses are hot.

Answers

Answer:

False.

Explanation:

Other Questions
Help I will Mark Brainliest!!!Choose one image from the article and look into whether it actually has been photoshopped, and the historical significance of the photoshopping. (Why would it need to be photoshopped? How might this affect our perception of history?) ALSO, LINK THE INFORMATION YOU FIND TO "1984"!This should be more than one paragraph (3-4) and should include MLA citations for your sources Submit your answers here. 7th grade math plss helpp How many awards did Muhammad Ali win? A scientist completes a thermal decomposition reaction. 12.25g of calcium carbonate, CaCO3, is heatedand forms calcium oxide, Cao, and carbon dioxide, CO2.a. Write a balanced chemical equation to demonstrate this reaction. Include state symbols.b. Calculate the number of moles of calcium carbonate that is thermally decomposed in thisreaction.Ok When should quotation marks be used? A title of short works, title of long works, symbol for inches, direct quotation litle of short works, humor or irony, symbol for leer, direct quotations and paraphrasing C. title of short works, strong emotion or emphasis, symbol for feet, indirect quotation D. title of short works, some cases of humor or irony symbol for inches, direct quotation Please select the best answer from the choices provided For a custom App uploaded to Microsoft Teams, if an organization wants to disallow users from updating the settings of the custom tab, which attribute name must be set to false in the manifest file What type of climate does equatorial rainforest experience? The following data relates to the scores obtained by 9 salesmen of a company in an intelligence test and their weekly sales in thousands of Rs.Salesmen: A B C D E F G H I Test score : 50 60 50 60 80 50 80 40 70 Weekly sales : 30 60 40 50 60 30 70 50 60 Obtain the regression equation of sales on test scores of the salesmen and estimate sales if the test score of a salesman is 65. solve for x: 12x - 4 = 68 If p(x)= x^2 - 2root2x + 1, then p(3root2)= ? How long is the light beam from the top of the lighthouse to the ground? Round to the nearest tenth. The light house is 25m tall and a boat is 180m from the base Which breakfast would be best on the morning of a test?O wafle with syrup and strawberriesO cereal with milk and a sweet rollO yogurt, banana, and wheat toastomelet, an orange, and a doughnut A statistical procedure that estimated regression equation coefficients that produce the lowest sum of squared differences between the actual and predicted values of the dependent variable is called . Shawna needs to buy apples to bake pies for the fair. She needs 13 pounds of apples. At one market, shefinds apples selling for $1.89 a pound. At another market she finds a 15-pound bag of apples for $26.99.Which market has the better deal? What is the least common multiple of 12 and 22Please help me what is the estimate of the product 11/12 x 4/5 There has been a persisting American influence in____and a persisting French influence in____.Group of answer choicesMelanesia/MicronesiaMelanesia/PolynesiaPolynesia/MicronesiaMicronesia/PolynesiaPolynesia/Melanesia A machine used 48% of its oil. What fraction of its oil did the machineuse?Need answer ASAP please and thank you What will you see on the next line?>>>myList = [5, 6, 10, 6, 32]>>> myList.remove(6)>>> myList The outcome of the Supreme Court case Marbury v. Madison defined the constitutionality of theFederalists.Judiciary Act of 1789.Jefferson presidency.Bill of Rights. Steam Workshop Downloader