Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer 1

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:


Related Questions

Which of theses nutrients can be found in all organisms?

Nitrogen
Calcium
Carbon
Phonsphorous

Answers

Answer:

Carbon

Explanation:

Carbon is found in all living organisms

Most of the matter in space is in a fourth state of matter called _____, which is high-energy matter consisting of positively and negatively charged particles.
A. plasma
B. state
C. matter
D. liquid

Answers

Answer:

dark matter

......................

Help pls asap ...... in the pic below

Answers

Answer:

ask your teacher

Explanation:

Based on what you were told about the
reproduction of the snails, write a question that
could be researched.

Answers

Answer:

If they aren't hermaphrodites, can they still be male and female at the same time?

Explanation:

Which type of stress force produces reverse faults? a. shearing b. tension c. compression d. deformation

Answers

Answer: c. (Compression)

Explanation:Compressional stress, meaning rocks pushing into each other creates a reverse fault.

hope this helps<3

Answer:

I did this for points- SIIIKKKKEEEEE THE ANSWER IS COMPRESSION

Explanation:

PLEASE HURRY!!!
Which type of seedless plant has horizontally branching stems covered with scale-like leaves and bearing vertical shoots?

1. club moss
2. horsetails
3. ferns
4. whisk ferns

Answers

Answer:

club moss

Explanation:

Answer:

club moss

Explanation:

A club moss ranges from .5 to 12 inches in height.

Which two processes cause sand particles to form sandstone?

Answers

Answer:

cementation

compaction

Explanation:

HOPE THIS HELPS:)

Collect information about the kind of waste produced in your house daily and how it is disposed off

Answers

Answer:

The different classes of waste produced in a house can be classified as follow: organic waste, liquid waste, solid waste and recyclable waste

Explanation:

In family homes, it is important to understand which are the types of waste in order to know how to dispose of them properly in an environmentally friendly way. First, liquid waste from the bathroom and kitchen is usually directed to the main sewer line or eliminated by septic tanks that serve as sewage collectors. Second, organic and recyclable waste is biodegradable, thereby this type of waste is usually disposed of in incinerators or landfills. Third, solid non-hazardous waste can be eliminated by compressing with mechanical systems and covered with earth to be finally compacted.

Why do you think that space exploration was pursued despite the risks

Answers

Answer:

Because mankind has never stopped pursuing knowledge. It's the thing we all seek. It's something that may get us killed, but may also bring us exactly what we were looking for. People spend their entire lives looking for knowledge, and with the Cold War going on beating the Russians just made seeking the knowledge we wanted as Americans just that much more sweet.

Explanation:

lol im a nerd

A semi-permeable membranous sac contains a 4% NaCl, 96% water solution. This sac is placed into a beaker containing a 16% NaCl, 84% water solution. The membrane is permeable to NaCl. Which way will NaCl flow across the membrane (into or out of the sac)?

Answers

Answer:

Should be going out of the sac because the molecules has to balance the concentration not sure tho

Which of the following domains include prokaryotic organisms?
A. Archaea only
B. Eukarya only
C. Archaea and Bacteria
D. Bacteria only

Answers

C. Archaea and Bacteria

Archaea and Bacteria are categorized into the domains of prokaryotic organisms, hence option C is correct.

What are prokaryotic organisms?

There are three domains of the life the Archaea, the Bacteria, and the Eukarya, in which Archaea and Bacteria belong to prokaryotic cells but eukaryotic cells belong to the Eukarya domain.

Prokaryotic organisms include the organism's absence of a nuclear membrane and not having well-defined cell organelle, this includes bacteria. It is a unicellular organism having an asexual mode of reproduction.

The Eukarya domain includes the eucaryotic cells having a true nuclear membrane, this domain includes all the eukaryote plants the human beings.

Therefore,  Archaea and Bacteria is the correct option.

Learn more about the prokaryotes, here:

https://brainly.com/question/1699177

#SPJ2

Which of the following does not describe neuroglia cells?
They support the nervous system.
They are 60% of the nervous system.
They protect the nervous system.
They conduct nerve impulses.

Answers

Answer:

Explanation:

Key Points There are two kinds of neuroglia in the peripheral nervous system (PNS): Schwann cells and satellite cells. Schwann cells provide myelination to peripheral neurons. Satellite cells play an important role in modulating the PNS following injury and inflammation.

fill in the blank
based on available evidence, many scientists have concluded that the earth's climate is changing BLANK than in the past, due to BLANK activities

Answers

Answer:1) faster 2) human

Explanation:

3. What is the relationship between the lungs of a human and the chloroplasts of a greenhouse plant
in the oxygen cycle? (4 points)

Answers

Answer:

Lungs in human is the site where gaseous exhange takes place hence reducing oxygen in the cycle while Chloroplasts are kinda species of the green pigment ( chlorophyll ) which enables photosynthesis which requires oxygen to take place hence reducing oxygen in the cycle

Which of the following cells is formed by meiosis?
O A. A fertilized egg
O B. A sperm cell
O C. A heart cell
O D. A bacterial cell

Answers

Answer:

B. A sperm cell

Explanation:

Meiosis creates gametes/sex cells, such as the sperm and egg.

So, sperm cells are formed by meiosis.

Meiosis doesn't create fertilized eggs, it instead creates normal egg cells.

Meiosis also doesn't create heart and bacterial cells because those are made in mitosis.

So, B is the correct answer.

Which of these will give the MOST accurate and precise measurement of 15mL of liquid to be placed in a test tube?

Answers

Answer:

the answer is 25ml graduated cylinder

Explanation:

........................

which event is most likely to lead to a heat wave ??

Answers

Answer:

A

Explanation:

Hope this helps

Answer:

b

Explanation:

What is an open access journal?

Answers

Answer:

Open access (OA) refers to free, unrestricted online access to research outputs such as journal articles and books. OA content is open to all, with no access fees. ... One involves publishing articles or books via the OA route on a publisher's platform (often referred to as gold open access).

What is the function of a motor neuron?
A.Controls muscles
B.Connects other neurons
C.Connects spinal cord to brain
D.Connects parts of the brain

Answers

C. The brain sends messages to the spinal cord

the gene for a particular trait that is passed only from fathers to sons is most likely...
a. autosomal recessive
b. autosomal dominant
c. co-dominant
d. incompletely dominant
e. Y-linked
f. X-linked

Answers

Answer:

e. y-linked

Explanation:

Because women have XX chromosomes they will inherit an X from their mom and an X from their dad.

However, men have XY chromosomes so they inherit an X from their mom and a Y from their dad.

If the father had a trait attached to his y chromosome he would not pass it to his daughters, but it would pass on to his sons.

What are the two main categories of contaminants in water?

Answers

Answer:

physical contaminant

chemical contaminant

Physical and chemical

PLZ HELP!!!
why do plants need carbon dioxide?

Answers

Answer:

both are correct!!

Explanation:

Carbon dioxide plays an important part in vital plant and animal process, such as photosynthesis and respiration. ... Plants and animals, in turn, convert the food compounds by combining it with oxygen to release energy for growth and other life activities. This is the respiration process, the reverse of photosynthesis.

Answer:

im positive that its both

Explanation:

hope this helps

How can we explain the observation that traits, such as skin color, are fairly consistent within a racial group, but alleles for skin color are not consistent

Answers

Answer:

Skin color is a quantitative trait influenced by the combined action of many genes, thereby different gene pools can result in the same skin color.

Explanation:

Quantitative traits (also known as continuous traits, ) are phenotypic traits that depend on the combined action of many genes and the environment. These traits show continuous variation, changing gradually over a range of values in the population. Examples of quantitative traits include height, skin color, weight, etc. A gene pool is the sum of all the individual genes in a population. In consequence, different populations may show different allele combinations (gene pools) that result in the same phenotype for a quantitative trait (skin color).

what is the basic unit of classification of living beings​

Answers

Answer:

The basic unit of classification of living beings, from the taxonomic point of view, is species.

Explanation:

Taxonomy is a discipline that deals with the classification of living beings, its basic unit of classification being the species category.

A species includes all the individuals with morphological and functional similarities, which also have the capacity to make crosses among them and have a descendant with the same characteristics, including fertility.

Which statement correctly describes the number of chromosomes in body cells and gametes?

Answers

Answer:

its A

Explanation:

Body cells and gametes are both diploid correctly describes the number of chromosomes in body cells and gametes.

What are chromosomes?

A chromosome is a long DNA molecule with part or all of the genetic material of an organism. In most chromosomes the very long thin DNA fibers are coated with packaging proteins; in eukaryotic cells the most important of these proteins are the histones.

Chromosomes are threadlike structures made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell. In plants and animals (including humans), chromosomes reside in the nucleus of cells.

One molecule of DNA and one protein make up one chromosome. Chromosomes are different sizes, and proteins called histones allow them to pack up small enough to fit in a nucleus.

Learn more about chromosomes:

https://brainly.com/question/1596925

#SPJ2

In homologous recombination in E. coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is:

Answers

Answer:

RecBCD enzyme

Explanation:

RecBCD is an enzyme of the E. coli bacterium that initiates recombinational repair from potentially lethal double strand breaks in DNA which may result from ionizing radiation, replication errors, endonuclease, oxidative damage, and a host of other factors. The RecBCD enzyme is both a helicase that unwinds, or separates the strands of DNA, and a nuclease that makes single-stranded nicks in DNA.

Which populations are affected most by density dependent limiting factors?

Please help!!!!!

Answers

Answer:

Density-dependent factors include disease, competition, and predation. Density-dependant factors can have either a positive or a negative correlation to population size. With a positive relationship, these limiting factors increase with the size of the population and limit growth as population size increases.

Explanation:

When an organelle stops
functioning properly, which of
the following occurs?

Answers

Answer:

B.

Explanation:

When an organelle stops functioning properly, what is most likely to occur is that such organelles would be removed from the cell by lysosomes. the correct option, in this case, would be B.

Lysosomes are small spherical molecules with single membranes. The organelle primarily functions in the digestion of cell macromolecules and dead organelles.

Thus, the content of the lysosome is usually filled with digestive enzymes such as protease, lipase, nuclease, etc.

Lysosomes are protected from their own enzymes because of the membrane surrounding them. The contents are not allowed to spill out.

More on the lysosome can be found here: https://brainly.com/question/1945886

Which is a renewable source?

Answers

Answer:

wood

Explanation:

You can grow trees quickly, but it takes the Earth a long time to create petroleum, iron, and coal.

Which statement about carcinogens is TRUE? *

1)asbestos and tobacco smoke are known carcinogens
2)carcinogens are unavoidable
3)carcinogens can be inherited
4)cells divide more slowly after being exposed to a carcinogen

Answers

Answer:

2)carcinogens are unavoidable

1) asbestos and tobacco smoke are known carcinogen
Other Questions
Larry comes to your office to file his 2020 tax return and tells you that he never received an Economic Impact Payment (EIP) during 2020. It appears that he should have qualified. You assist Larry in checking the Get My Payment tool at www.irs.gov, where it says that a payment was deposited to a bank account that Larry states is not his. Larry will need to: Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur. I need help ASAP!! Which factor most contributed to the United States becoming a more multicultural society during the late 1700s and early 1800s? In conversation with a mental health experta) Develop a questionnaire to conduct an interview with an expert on mental health (psychologist/ counselor / mental health org /NGO working on mental health/ school counselor / Special educator)b) Conduct the interview and make a record of the responses to understand the concern of emotional health, stress, and mental health issues.c) Write a reflective essay-(150-200 words) 1. express your feeling on what you learned and understood.2. empathy and sensitivity gained about the topic.d) Write Empathy in Action Plan with 5 ways in which you plan to behave and support anyone with determination or mental health challenges around you. simplify 25+ (15 - 10) Find the maximum velocity possible for the person on the swing. if someone could explain with work that would be very much appreciated since I wasn't there when this was discussed in class. You know Dasher and DancerAnd Prancer and Vixen,Comet and CupidAnd Donner and Blitzen.But do you recallThe most famous reindeer of all?Rudolph, the red-nosed reindeerhad a very shiny nose.And if you ever saw him,you would even say it glows.All of the other reindeerused to laugh and call him names.They never let poor Rudolphjoin in any reindeer games.Then one foggy Christmas EveSanta came to say:"Rudolph with your nose so bright,won't you guide my sleigh tonight?"Then all the reindeer loved himas they shouted out with glee,Rudolph the red-nosed reindeer,you'll go down in history! Which of the following is given the responsibility of creating courts? Group of answer choices A. President B. Congress C. A bipartisan committee of state governors D. US Supreme Court Match the words that have the same denotations.smiledluckymockedsoakedhappyfavoredarrowBothdrenchedarrowBothgrinnedarrowBothscoffedarrowBothelatedarrowBoth Corina read 1/12 of her book in 1/3 of an hour. How much of her book will she have read in 1 hour? A: 1/36 B: 2/3 C: 1/4 D: 1/2. Choose correct answer. Plz and thx. How did German people feel about their nation after World War I? They were pleased about Germanys new position of power. They were unhappy that Germany lent money to the United States. They were angry at German leaders for losing the war to the Allies. They were relieved that the German economy had improved. The graph shows the soulution What is an example of a strong hook for a text trailer?a librarian stacking books on shelves in a librarya police officer chasing a criminal down a streeta teenage girl studying for a test in her bedrooma father cooking dinner in a kitchen for his family denada por los puntos What can be used as a tracing powder when checking for small oil leaks 3.) Which two organ systems provide materials required for the humanbody to produce ATP?*O (1) reproductive and excretory(2) digestive and respiratory(3) respiratory and immune(4) digestive and reproductive Find the value of x and y. Show all your work neat andin order. Simplify the equation: (3-5+2)(4-12-1) how did france react to king louis xiv's death whitch country created the first printed newspaper Steam Workshop Downloader