simplify the expression
xy + 4x – 3xy – x

Answers

Answer 1

Answer:

-2xy+3x

Step-by-step explanation:

xy + 4x – 3xy – x: You need to collect like terms

-2xy+4x-x

-2xy+3x

Your final awnser would be -2xy+3x


Related Questions

during a musical an orchestra is playing. as the music plays, the volume changes in the beginning of the piece can be modeled by the equation s=10|x-4|+50 where s represents the sound level in decibels and x represents the number of measures of music played. explain in words each step to find the following question:

at what number(s) measures played would the sound level be at 80 decibels?​

Answers

Answer:

X = 1 ; x = 7

Step-by-step explanation:

Given the equation:

s=10|x-4|+50

s = sound level in decibels ; x = number of measures of music played

Take away 50 from Both right hand and left hand side of the equation

Recall s = 80

80 - 50 = 10│x - 4│+ 50 - 50

30 = 10│x - 4│

To get rid of the absolute value sign, append ± to left hand side

± 30 = 10x - 40

Minimum value of x : - 30 + 40 = 10x ; 10 = 10x ; x = 1

Maximum value of x : 30 + 40 = 10x ; 70 = 10x ; x = 7

2. Find the value of x for which l | | m.​

Answers

2x-5=95 due to the alternate interior angles thm so you just add 5 to 95 to get 2x=100 then divide by 2 to get x=50!

What is the sum of this expression?
2 1/16 + 7 3/8

A. 9 1/4

B. 9 7/16

C. 9 3/4

D. 9 7/8

Answers

Answer: [tex]9\frac{13}{24}[/tex]

Step-by-step explanation:

Add 2 and 7.

9

Add 1/16 and 3/8 = 13/24

9 13/24 is the answer.

Answer:

b. 9 7/16

Step-by-step explanation:

2 1/16 + 7 3/8

= 33/16 + 59/8

= 33/16 + 118/16

= 151/16

= 9 7/16

A daycare charges $45 a week to tutor a child. If a parent is late to pick up their child, it is an additional $7 per hour. If in one month a parent pays $271, how many hours was this parent late this month?

Answers

The parent was late 13 times this month

Answer:

13 times

Step-by-step explanation:

What is the slope of the line that goes through (5,-11) and (-9, 17)?

Answers

Answer:

-2

Step-by-step explanation:

We can use the slope formula

m = ( y2-y1)/(x2-x1)

    = ( 17 - -11)/( -9 -5)

    = ( 17 +11)/( -9 -5)

    28/-14

  = -2

Answer: -2

Step-by-step explanation:

X=-9-5=-14

Y=17 - - 11=28

28/-14=-2

A finance magazine did a survey and found that the average American family spends $1,600 on a summer vacation. If the distribution is normal with standard deviation $411, find the amount a family would have spent to be the 80th percentile. PreviousNext

Answers

Answer:

$1945

Step-by-step explanation:

Let X be the normal distribution

Kindly find attached a detailed annotation of the solution to the problem.

in the attached document, we found the value that corresponds to  80th percentile, hence we found the value such that the probability that the variable x is lower than this value is 0.8.

Also, from the calculation, we found that the value which corresponds to the 80th percentile is $1945

An online streaming service deducts $7 from Serena’s account every month of a year. After 1 year, how much do the streaming service fees change Serena’s account?

Answers

Answer:

$84

Step-by-step explanation:

This is a super simple question. All you have to know is how much money will be charged a month, and how many months there are in a year. Just simply multiply 7 by 12 as the streaming service is charging 7 dollars a month and there are 12 months in a year. After you multiply the two numbers, you should end up with 84 dollars charged after 1 year.

I think it's $84. Because there are 12 months in a year and they take $7 per month.

What does the slope of the graph represent?

Answers

Maybe try putting the graph?
Can u put a picture of the graph to help u?

what is 1000+194728573857275939868385937583957389583898389583958398395

Answers

Answer:

there is no way that is an actual question

Step-by-step explanation:

194728573857275939868385937583957389583898389583958399395

On average, Asia makes 14 out of 20 free throws. Assuming the relationship is proportional, how many more free throws is she likely to make if she shoots 150 free throws?

Answers

Answer:

105 free throws made if Asia shoots 150

Step-by-step explanation:

Find the percentage form of 14 out of 20

14 / 20 = 0.7 (70%)

Then calculate 70% of 150:

0.7 multiplied by 150 = 105

(Can check by doing 105 / 150 = 0.7)

Asia will make 1058 free throws out of a total of 150 shoots.

What is the percentage?

The percentage is defined as a given amount in every hundred. It is a fraction with 100 as the denominator percentage is represented by the one symbol %.

The percentage is also called the indicating hundredths. Thus, 2% is two-hundredth, which means 2%=2/100=0.02.

The percentage is just like the amount of that value but between 1 to 100 and it is very useful to predict for example if you say 678 then we have to know about the full number also but if you say 80% then it becomes clear.

Given that,

Asia makes 14 out of 20 free throws

Percentage free throws = free throws/total  × 100

Percentage free throws = 14/20 × 100

Percentage of free throws = 70%

Now,

If Asia throws 150 then with the same proportion she will again make 70% of her throw free.

So,

70% of 150 = 150 × 70/100 = 105

Hence "Asia will make 1058 free throws out of a total of 150 shoots".

For more about the percentage,

brainly.com/question/13450942

#SPJ2

Can anyone help? T^T
4/3n - 8 = -6
Thanks :3

Answers

4/3n-8=-6
4/3n=2
N=1.5

Answer:

CHERRY I NEED U

Step-by-step explanation:

11) -14 - 8x = -2(-3x + 7)
Needing some help with this

Answers

Answer:

x = 0

Step-by-step explanation:

First, distribute the -2 to the parentheses:

-14 - 8x = -2(-3x + 7)

-14 - 8x = 6x - 14

Add 14 to both sides:

-8x = 6x

Subtract 6x from both sides:

-14x = 0

Divide each side by -14:

x = 0

So, x = 0

Answer:

0

Step-by-step explanation:

-14-8x=6x-14(cancel equal terms)

-8x=6x(move the variable to the left)

-8x-6x=0(collect like terms)

-14x=0Divide both sides)

x=0

Pls help me fast! Thank you! 10 points

Answers

I think it’s -3/2 might be wrong though

HELP PLEASE I NEED IT ASAP

Answers

Answer:

849.9 cm squared

Step-by-step explanation:

The answer is a. Hope this helped!

A parking lot is 20 feet long. One tortoise starts at the edge of the parking lot and moves at a rate of 6 feet per minute. Another tortoise starts 4 feet from the edge of the parking lot and moves 2 feet per minute. Write an equation to represent when they will be in the same spot.

Answers

Answer:

Kindly check explanation

Step-by-step explanation:

Length of parking lot = 20 feets

Speed of tortoise which starts at the edge = 6 feets per minute

Speed of tortoise which starts 4 feets from the edge = 2 feets per minute

Equation to represent when they will be in the same spot.

Distance = speed * time

Distance of Tortoise at edge = 6ft/min * t = 6t - - (1)

Distance of the other tortoise = (4 + 2t) - - - (2)

Equating both (1) and (2)

6t = 4 + 2t

6t - 2t = 4

4t = 4

t = 4/4

t = 1

Hence, they'll be at the same spot after 1 minute.

10x+8= 5x -4


Pleaseeee help

Answers

The answer is X=-12/5

Step-by-step explanation:

Here's the answer I hope it will help u

An athlete is jumping. However, every time she jumps she gets a bit more tired, and every jump goes 1/2 as far as her prior jump. Now, for her very first jump, she goes 1/2 of a foot. On her second jump, she goes 1/4 of a foot, and so on and so forth. How many jumps does it take for her to travel 1 foot?Immersive Reader

Answers

Answer:

She will never complete 1 foot

Steps:

1) We will find the maximum value of this process, when this is carried out infinite times.

This process goes like a Infinite GP, whose

First term,a = 1/2ft.

Common Ratio, r = 1/2ft.

Maximum value of this process is One Foot when the athlete jumps forever or Practically, she will never complete her 1 foot.

Hence, Athlete will never complete. her complete .

Starting from 1/2 ft. ,and ending at 1 foot.

The value always tends toward 1 but never reaches one.

QS bisects ∠PQR. If m∠PQS = (5x)⁰ and m∠RQS = (2x + 6)⁰, then what is m∠PQR? Draw a picture and label before solving. *

Answers

Answer:

m∠PQR = (7x + 6)⁰

Step-by-step explanation:

Please find the diagram in the attachment.

Mathematically, since the angle PQR is bisected by the given line, it means that;

RQS + PQS = PQR

Thus;

PQR = (2x + 6) + 5x

PQR = 2x + 6 + 5x

PQR = 7x + 6

m∠PQR = (7x + 6)⁰

Need help asap! Tysm

.    。    •   ゚  。   .

   .      .     。   。 .  

.   。      ඞ 。 .    •     •

  ゚   Black was not An Impostor.  。 .

  '    1 Impostor remains     。

  ゚   .   . ,    .  .

Answers

3 inches
36 / 12 = 3
Area / height = base

Answer:

Ohhhhhhh 3 inches

Step-by-step explanation:

Divide. Give the quotient and remainder.
7520 : 39
quotient:
Remainder:

Answers

Quotient: 192
Remainder: 32/39

.!.!.!$$.!.!.!help !!.!.!

Answers

Answer:

y=9

Step-by-step explanation:

Plugin what we know

[tex]\frac{y}{12} =\frac{3}{4}[/tex]

Simplify the equation by using cross-multiplication

4y=36

Divide both sides of the equation by 4

y=9

If this helped, please rank me brainliest! :)

Answer:

Y would be 9

Step-by-step explanation:

If the x is 12 and it shows the simplified version take the 4 and multiply it by how much you would need which is 3 so you go to the 3 above 4 and multiply it by 3 and you will get 9/12

Sorry if its a bit hard to understand but hope this helps!

What is the midpoint between -5,-4 and -3,3?

Answers

Answer:

(-4,-0.5)

Step-by-step explanation:

midpoint = ((x1+x2)/2, (y1+y2)/2)

               = ((-5+-3)/2, (-4+3)/2)

               = (-8/2, -1/2)

               = (-4,-0.5)

What is the formula for finding slope?

Answers

Answer:

To find the slope of two given points, you can use the point-slope formula of (y2 - y1) / (x2 - x1). With the points plugged in, the formula looks like (3 - 2) / (4 - 1). Simplify the formula to get a slope of ⅓.

Step-by-step explanation:

HOPE THIS HELPED ✨

write 2x X(5y-y)/2 in a simplified form

Answers

Answer : the simplified form is 4xy.


Four less than the product of 6 and a number equals 3

Answers

Answer:

-1/6 (written as a fraction)

Step-by-step explanation:

our goal here is to get n by itself

6n-4=3

add 4 to both sides

6n=-1

divide both sides by 6

n= -1/6 (a fraction)

Classify the following number: - 1/6

Answers

Answer:

fraction and integer

Step-by-step explanation:

A triangle has sides with lengths of 38 feet, 56 feet, and 69 feet. Is it a right triangle?

Answers

Answer:

No

Step-by-step explanation:

Assume that it is a right triangle for now

According to the Pythagorean Theorem...

(38)^2 + (56)^2 = (69)^2

4580 ≠ 4761

Both sides are not equal, and hence the Pythagorean Theorem can't be applied to the triangle. It is not a right triangle.

(6×10^2) ÷ (3×10^-3)

Answers

Answer:

2*10²

Reduce the expression, if possible, by cancelling the common factors.

Scientific Notation:

Hi!

Lets go through this together.

Using the operation, PEMDAS, we start from left, then go to right.

since there are two pairs of parenthesis, we start with the one on the left.

(6x10^2)

so now, we do the exponent, 10^2

10x10= 100

So our answer for this part is 100.

Now we have (6x100)

6x100=600

So now, the equation is 600÷(3x10^-3)

Now, we do the parenthesis on the right.

(3x10^-3)

First, we do the exponent, 10^-3

10x-10x-10= 1,000

so now, the equation is (3x1,000)

Now, we multiply.

3x1,000=3,000

So now, the equation is 600 ÷ 3,000

600 ÷ 3,000 = 0.2

So, your answer is 0.2.

__________________________________________________________

(6 x 10^2) ÷ (3 x 10^-3)

=(6 x 100) ÷ (3 x 10^-3)

= 600 ÷ (3 x 10^-3)

= 600 ÷ (3 x 1,000)

= 600 ÷ 3,000

= 0.2

(also, the scientific notation is 2x10^2)

__________________________________________________________

Hope this helps!

Let me know if you need anymore help!

Yours truly,

~~~PicklePoppers~~~

Paul has $145 in his savings account. He earns $36 a week mowing lawns. If Paul saves all of his earnings, after how many weeks will he have $433 saved?

1: 8 weeks

2: 288 weeks

3: 252 weeks

or 4: 7 weeks

Answers

Begin the question by subtracting the money that Paul already has ($145) from the amount that Paul wants to get to ($433).
$433-$145=$288

Then use the answer $288 and divide it by Paul’s earnings.
$288/$36= 8 weeks

It will take Paul 8 weeks to save $433.

Please help asap! Add using the number line.


​ 1.4+(−0.8) ​


Select the location on the number line to plot the sum.

Answers

Answer:

0.6

Step-by-step explanation:

1) 1.4-0.8 (A negative and a positive equals a negative, then you just subtract. On the number line you would start at 1.4 and go back)

hope this helps!

Other Questions
if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants which part of the government according to the constitution, should be made up to two representatives per state? (Apex) A. the senate B. congress C. the Articles of confederation D. the House of representatives (4x5)+6x4+(9-3) (5+6) show your work