_____ splits water into 1/2 O2, H , and e- . A structure of a thylakoid. Letters from A to E indicate definite structures. Letter A indicates the first protein complex located in the thylakoid membrane. Letter B indicates a multiprotein complex between two complexes A and C. Letter C marks the second integral membrane protein complex. Letter D marks a substance inside the thylakoid. Letter E indicates a flask-shaped structure in the membrane of the thylakoid, which has a canal through the membrane. D B C A E

Answers

Answer 1

The luminous reactions begin when light reaches photosystem II. The water molecules provide electrons to the photosystem, releasing oxygen and protons. The letter A represents photosystem II that splits water.

-----------

1. Luminous energy is trapped by chlorophyll in Photosystem II.

2. When the pigment molecules absorb light, electrons provided by water molecules get in a higher energy level.

3. The excited electrons go through the electron transport chain from Photosystem II to a less energetic level in photosystem I.

4. When the excited electrons leave photosystem II, they are replaced by new electrons extracted from the water molecules.

5. Luminous energy absorbed move the electrons from the photosystem I to another electron acceptor, from where they get transported again and used to produce NADPH molecules.

6. When electrons leave Photosystem I, they are replaced by new electrons coming from photosystem II.

7. When the water molecule breaks down, hydrogen ions remain in the thylakoid lumen, from where they are pumped to the stroma by the ATP synthase.

8. The released energy is used to produce ATP molecules.

9. Hydrogen ions go back from the stroma to the thylakoid compartment.

-------------------------------------------------------------------------

Related link: https://brainly.com/question/13516273?referrer=searchResults

                    https://brainly.com/question/8109609?referrer=searchResults

                     https://brainly.com/question/6563090?referrer=searchResults


Related Questions

describe a chemical reaction

Answers

Answer:

The chemical reactions is a process in which one or more substances, the reactants, are converted to one or more different substances, the products.

Explanation:

.

Answer:

A chemical reaction is a process in which the reactants are converted into one or more different substances. A chemical reaction occurs when certain bonds between the atoms are formed or broken. The substances that are formed at the end of the reaction are called products.

Hope this helps! :)

refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity​

Answers

Answer:

Gender Role

Explanation:

How people already see how people should act. Example- Be a man.

Answer:

b. sex

Explanation:

edge 2021

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

what is a similarity of an ecosystem and a habitat

Answers

Answer:

Habitat and ecosystem are two ecological terms.Both include living organisms. Organisms live in both systems.

Hope this helps!

Answer:

Both include living organisms. Organisms live in both systems

Explanation:

Answered by NONE other than the #QUEEN herself aka #DRIPPQUEENMO

HOPED THIS HELPED!!

Tropical rainforests have the greatest biodiversity of any type of land ecosystem how does biodiversity contribute to the sustainability of an ecosystem

Answers

Biodiversity contributes to the sustainability of an ecosystem in ways such as biodiversity, ecosystem stability, ecosystem resilience, nutrient cycling, pollination, and medicinal properties.

Biodiversity is crucial for the sustainability of an ecosystem as it plays a significant role in maintaining the functioning of ecosystems and providing a range of ecological services. In tropical rainforests, which have the highest biodiversity, the presence of numerous species of plants, animals, fungi, and microorganisms contributes to the sustainability of the ecosystem in the following ways:

Ecosystem Stability: Biodiversity helps to maintain the stability of an ecosystem by providing a balance between predator and prey populations, nutrient cycling, and decomposition.

Ecosystem Resilience: The greater the biodiversity of an ecosystem, the more resilient it is to disturbances such as climate change, natural disasters, and human activities.

Nutrient Cycling: Biodiversity helps in the efficient cycling of nutrients in the ecosystem. Different species of plants and microorganisms play a role in decomposing organic matter, recycling nutrients, and maintaining soil fertility.

In summary, biodiversity is essential for the sustainability of ecosystems. It provides ecological services that are critical for maintaining the functioning of the ecosystem and contributing to human well-being.

To learn more about Biodiversity here

https://brainly.com/question/29765125

#SPJ1

The pancreas secretes enzymes and bicarbonate into the a. esophagus c. duodenum e. ileum b. stomach d. jejunum

Answers

Answer:

C. Duodenum

Explanation:

hope this helps!

the answer should be the duodenum

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

What hormone carries out hydrolysis? Explain.

Answers

Answer:

the HGH hormone

Explanation:

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

Create a food chain with a producer and 3 consumers.

Answers

Answer: dandelion is consumed by bees, grasshoppers, and butterflies.

Answer:

primary consumers, secondary consumers, tertiary consumers.

Explanation:

Hope this helps

A moon has less mass than a star and more mass than a planet it orbits.
•True
•False

Answers

It is false bc the mass of moon is less than 1/2 of earth, and earth is tinier than ANY STAR

The probability that an “X” bearing egg will be fertilized by a “Y” bearing sperm is?

Answers

Answer:

100%

Explanation:

The different forms of the beef cattle color gene are called_

Answers

The answer is right there click on it 271 the beef is colored red

The different forms of the beef cattle color gene are called "alleles"

What are alleles?

Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.

In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.

The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.

Learn more about alleles, here:

https://brainly.com/question/14104138

#SPJ6

Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

What was the result of the Reconstruction Amendments (the Thirteenth, fourteenth, and fifthteenth Amendments)?

Answers

Slavery was abolished and voting rights were extended to all male citizens. The Thirteenth Amendment (ratified in 1865) abolished slavery. The Fifteenth Amendment (ratified in 1870) extended the voting right to all male citizens without discrimination in terms of race, color, or previous servitude.

What is the process of the digestive system?

Answers

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.

Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose

Answers

Answer:

 A

Explanation:

     

please help asap

Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:

Answers

Answer:

humans- exposes them to the ultra-violet rays of the sun causing cancer

animals- causes the pollution of gases found within the atmosphere

plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants

Environment- causes global warming

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass

Answers

Answer:

A

Explanation:

The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^

Explanation:

A because im big brain

What does the phrase of sunshine and of song mean in the poem?
A.
memories
B.
weather
C.
happiness
D.
singing

Answers

Answer:

a

Explanation:

correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat

Answers

The correct answer is D

Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-

Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-

The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-

A new strain of influenza breaks out in New York City-

The population of rabbits and a population of deer are both feeding off the same plants in the same area-

Hurricane Katrina forced thousands of people to leave New Orleans-

65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.

Answer choices: Density Dependent
Density Independent

Answers

Answer:

Density Dependent

Explanation:

i think hope it helps

Question C. please... :) And NO FILES I WILL REPORT YOU!

Answers

The best way to describe it would be “the pattern of the graph is constantly changing as it goes thru series of increased and decrease through out the years”

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

true or false
Only animals have a niche.

Answers

Answer:

False

Explanation:

Answer:

True

Explanation:

which type of specialized cells would be found in an animal’s neuvous system?

Answers

Animal nerve cells are specialized cells called neurons. Depending upon function, these cells can be divided into sensory neurons, interneurons, and motor neurons.

The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.

What is the nervous system?

The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.

Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.

Therefore, the correct option is D. Cells that can transmit signals around the body.

To learn more about the nervous system, refer to the link:

https://brainly.com/question/29355295

#SPJ2

The question is incomplete. Your most probably complete question is given below:

Cells that transport oxygen are found in the blood.

Cells that secrete hormones to trigger cellular responses.

Cells secrete enzymes to break down food.

Cells that can transmit signals around the body.

6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.

Answers

Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?

Explanation:

What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.

Answers

Answer:

.

Explanation:

Answer: A, C, D. Hope this helps:

Explanation: Open Photo ;)

In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.

A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________

B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.

C. A short winged fly can be described -using words as what?

D. What type of inheritance is this called?

Answers

Answer:

A. Normal Wings= Ww, Small Wings=ww

B. All offspring will have short wings because short wings trait is recessive.

w. w

______

w| ww |ww|

————-

w|ww |ww |

______

Explanation:

Other Questions
Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death.