Answer:
idependent#1dependent#2and control variable is #3
Explanation:
The indwpendent variable in an experiment is the one that the scientist intentionally changes in an experiment. The dependent variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called Conttol variable
(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis
describes natural selection?
Observing Footprints from the Past
detective"O" (observation) or I (inference)
Answer:
dfvas
Explanation:
sadvadsssssss
What is the primary source of energy in a food change
Answer:
It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.
Explanation:
Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy
Answer:
A. Advanced Decision analysis
Explanation:
Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.
Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.
Answer:
Advanced decision analysis
Explanation:
I took the quiz on edge
why are index fossils useful to geologist
a.they tell the relative age of the rock in which they occur
b. they tell the ages of many different rock layers
c.they tell the age of the rock at one location only
d. they tell the absolute age of the rock in which they occur
Answer:
Explanation:
Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.
Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.
which I true of the rock layers shown below
Answer:
C
Explanation:
The fossil can get lifted due to water and other components
Help !!!!!!!!!!!!!!!!!!!!!
Answer: I would say D or the last answer
Explanation:
What properties of carbon explain carbon’s ability to form different large and complex structures?
Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?
Answer:
Are you against or with?
Explanation:
,.;1q23wt4y5eu6ri7ertyur
Search the NIH gene database for the term colorblindness. Use the results of the database search to explain how a father and mother who are not colorblind could have a son who is colorblind. Your model can be a pedigree chart, a Punnett square, or a diagram of chromosomes.
Answer/Explanation:
Red/green colorblindness is a recessive, X-linked condition. That means that the affected gene is on the X chromosome, and that the phenotype will only be present if there is no "healthy" gene, which is dominant to the mutated gene.
For two unaffected people to have an affected son, the mother must be a carrier. Remember, females have two X chromosomes and males have one. So if a female is a carrier of the colorblindness mutation, she will have one copy of the mutation and one normal copy of the gene, and will therefore be unaffected.
The punnet square (attached) shows that all their female children would be unaffected (have the B gene), but 1:2 male children would be colorblind, as their only copy of the gene is mutated (b).
Answer:
The person on top is awesome appreciate!!
Explanation:
got it right on edmmentum
why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?
Answer:
Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...
Explanation:
Answer:
compared to beef vegetables require less water like potatoes it takes 287 litres of water
Which has been observed in the study of embryology?
A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.
Answer:
D. Some traits in certain embryos disappear as the embryo develops
Explanation:
I don't know how I would explain it, but I can list some of the things that disappear such as... Gill slits, and tails. Hope this helped :D
Answer:
D. Some traits in certain embryos disappear as the embryo develops.
Explanation:
Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answer:
which are the letters with hightlight yellow?
When and how were the first trans fats made with vegetable oil?
Answer:
Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.
You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.
Answer:
The answer is WEIGHT
Explanation:
Which organelle houses the genetic material DNA?
Answer:
Image result for Which organelle houses the genetic material DNA?
nucleus
The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).
Explanation:
Nucleus is the organelle that houses the genetic material DNA.
What do you mean by organelle?
"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."
What do you mean by genetic material?
"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."
What do you mean by DNA?
"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."
What is called a nucleus?
"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."
To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190
#SPJ2
HELP PLEASE
Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.
Answer:
A band , I band
Explanation:
YOURE WELCOMEEE
Some one please help me!!!
Answer:
time
Explanation:
Answer:
revolution
Explanation:
Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?
Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).
Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic
The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.
In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.
Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.
The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.
Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic
Learn more here: https://brainly.com/question/2088739
plz help I will mark you brainlist plz
Answer:
1. Acid
2. Acid
3. Acid
4. Base
5. Acid
6. Bases
7. acid
8. base
9. acid ( could be both)
10. acid
*Anybody correct me if I'm wrong*
Explanation:
Viral DNA that is integrated into a bacterial chromosome is a
Answer:
Hidden virus.
Explanation:
It will sit in the cell's DNA for a while and then attack.
are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it
Answer:
C. Steroids
Explanation:
Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.
Answer:
steroids
Explanation:
so c
does fab laundry detergent contain enzymes
Answer:
yes
Explanation:
almost all detergent has enzymes to help clean
i need help asap please
15 points
Answer:yes that is right you got it
Explanation:
Answer:
its D
Explanation:
photosynthesis happens with thy sun
When an organism consumes other organisms for food they are?
Answer:
Consumer
Explanation:
Producer An organism that can make its own food
Consumer An organism that obtains energy by feeding on other organisms
herbivores consumers that eat only plants
carnivores consumers that eat only animals
Why do you think the size of a white dwarft affects its visual luminosity?
Answer:
White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.
Explanation:
According to cell theory, which of the following are made of cells? Check all that apply.
- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin
Answer:
flowers
blood
bacteria
skin
According to cell theory flowers, blood, bacteria and skin all are made up of cells.
What is cell theory?The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.
Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.
Therefore, flowers, blood, bacteria and skin all are living things made up of cells.
Learn more about cell theory, here:
https://brainly.com/question/1468725
#SPJ2
4a. Describe two examples of non-living things that have one or more of these characteristics of
life.
Answer:
Water and Air
Explanation:
Water and air both are missing cells that living things have.
29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x
Answer:
B is the correct answer
Explanation:
4x10=40