To paraphrase properly you should
O rearrange the ideas in a different order
express the main ideas in your own words
O delete a few words to shorten the passage
O change several words to alter the passage

Answers

Answer 1

Answer:

Express the main ideas in your own words.

Explanation:

If you do the other methods you could risk plagarism (which is really bad). Expressing it in your own words is the best way to go.

Answer 2

I got the answer in the photo.

To Paraphrase Properly You ShouldO Rearrange The Ideas In A Different Orderexpress The Main Ideas In

Related Questions

Discuss different trade policies that are currently enacted and if they should be updated in some way. Then create your own policy about an area in the economy is currently not addressed in current trade policies.

Answers

The different trade policies are Unilateral Trade Agreement, Bilateral Trade Agreements and Multilateral Trade Agreements.

What are trade policies?

Trade policies are the policies that are made related to the import and export of the goods and services between countries.

There are different trade policies such as import tariffs,  voluntary export restraints, import quotas,  export subsidies, export taxes, etc.

Thus, the different trade policies are  Unilateral Trade Agreement, Bilateral Trade Agreements and Multilateral Trade Agreements.

Learn more about trade policies

https://brainly.com/question/27622280

#SPJ1

Which sentence describes the main conflict in this story? Sasha and Connie are best friends at Franklin Middle School. They are both members of the debate team. One day, they are forced to debate each other at the Franklin Middle School Debate Tournament. Sasha holds back, but Connie doesn't. Connie wins, and Sasha can't forgive her.

A. Sasha and Connie don't want to debate.

B. Sasha and Connie must debate each other.

C. Sasha and Connie can't work together.

D. Sasha and Connie may lose their friendship.​

Answers

Answer:

D.

Explanation:

ok its either B. or D. but I think its D. more than B.

Answer:

B

Explanation:

the question is what sentence describes the main conflict and the issue between them is that they have to debate tho D could be it D is more the result of and not the cause of

Read these lines from the poem and answer the question.
The monument sticks like a fishbone
in the city's throat
In these lines, the poet suggests that
the monument should have been torn down along with the aquarium
the monument is not attractive
the monument makes the people of the city uncomfortable because of the history behind it
the monument should have been placed in another part of the city

Answers

Explanation:

the monument makes the people of the city uncomfortable because of the history behind it

According to a recent survey, 65% of young people would like to study in a foreign country.

Opinion

Fact

Approximately one in three people who take part in voluntary activities say that it has made them feel better about themselves.

Opinion

Fact

Professor Mark Thompson believes that people from wealthy backgrounds tend to volunteer more than people from poorer ones.

Opinion

Fact

It has been proven that the main reason people volunteer is to help other people, although some people also do it in order to try a new experience.

Opinion

Fact

‘Instead of making people busier and more tired, taking part in voluntary activities may actually help decrease people’s stress levels,’ comments Clara Coleman, a researcher at Princeford University.

Opinion

Fact

‘Employers don’t appreciate people who do volunteer work alongside their normal jobs,’ suggests Joel Gateman.

Opinion

Fact

Answers

Answer:

1. Opinion

2.Fact

3.Opinion

4.Fact

5.Opinion

6.Opinion

Explanation:

I think that this would be correct

What did Storm hide from the owner and carefully “cover” it up?

Answers

Answer:passage?

Explanation:

PLEASE HELPPPPP!!!!!!!

What is a question you can ask when analyzing the structure of a text?

How are allusions used for effect?
How are main ideas developed?
How are the examples effective?
How are the points organized?

Answers

D) How are the points organizes

Explanation:

Seems to make the most sense.

aoqewgzxzc. j oin m ee t f or talki ng​

Answers

Answer:

joining

Explanation:

lemme join

are you alright ?? /gq

A_ _ _ _ _ _ _ is the most important metal used in air plane manufacturing.

Answers

Answer:

Aluminum is the most important metal used in airplane manufacturing

Explanation:

please help me!! please!​

Answers

1) My cat's name is Nisa

2)Like most cats,she has her own ways.

3)She scratches people when they pull her tail.

4)When the children goes out of the room she usually comes in

5)I think she is afraid of them.

6)She watches birds for a long time, but she doesn't catch them

7)I don't know why she often chases the vacuum cleaner

You just need to unscramble the words to make it have sense.

The paragraph:

My cat's name is Nisa.Like most cats,she has her own ways.Some examples of this is that she scratches people when they pull her tail.When the children goes out of the room she usually comes in.I think she is afraid of them.She watches birds for a long time, but she doesn't catch them.I don't know why she often chases the vacuum cleaner.

Answer:

1. My cat's name is Nisa

2. Like most cats, she has her own ways

3. She scratches people when they pull her tail

4. When the children goes out of the room she usually comes in

5. I think she is afraid of them

6. She watches birds for a long time, but she doesn't catch them

7. I don't know why she often chases the vacuum cleaner

Explanation:

Which theme do the actions of Della and Jim suggest most clearly?
A. Being wealthy make life easier.
B. Love is the greatest gift.
C. Beauty is in the eye of the beholder.
D. Time heals all wounds.

Answers

Answer:

B.) Love is the greatest gift. I hope this helped.

B love is the greatest gift

hi! please help quickly

Which of these is an example of a theme?

the reasons why a young boy hates sports
the importance of being there for your friends
the set of challenges that a blind child faces
the problems faced by a stray pup

Answers

Answer:

the answer would be the 2nd option! (the importance of being there for your friends)

Explanation:

themes can usually fall under an umbrella of categories, like that one! but the other options are too specific to just one story

Why did Ralphie have to stop after every block on his way to the library?
He was delivering newspapers.
B
The chain kept coming off his bike.
C
His handlebars were loose and had to be tightened.
D
He was tired because the library was so far from his house.

Answers

Answer:

D. He was tired and the library was so far from his house..?

Explanation:

PLEASE HELP! I NEED EXAMPLES! GIVING POINTS :)!
Write 4-5 sentences about this image.

Answers

The lord ganesh is floating on water

10. Nancy visited one of her elderly neighbors and noticed that she had a gun locked away in one of her

cabinets. During the visit, Nancy turned to her neighbor and asked, "Why do you have a gun in your

house?" Her neighbor simply said, "I am exercising my right to own a gun legally.".

Answers

2nd amendment— the right to bear arms

In conclusion more people should eat at home because?

Answers

Answer:

so u wont spread the corona virus

Eating at home is much more comfortable than having dinner or lunch in a public place. At home, we can be more relaxed than in a restaurant. We can wear comfortable, casual clothes; even pajamas. We can sit in a comfortable position on our favorite chair, on the sofa, or the floor. If we wish, we can watch TV or a video, or listen to a radio program. None of these can be done at a restaurant. Furthermore, at home, we do not have to worry about disturbing other diners and can talk and laugh as loudly as we want without fear of upsetting people sitting nearby us. In conclusion, it is my opinion that for reasons of comfort, cost and health, eating at home is preferable to eating in a restaurant or at a food stand. Although I enjoy eating out now and again and usually do so about once a week, it is not something I could do every day. Sitting in my comfortable clothes, in front of the TV, and with a good, home-cooked meal in front of me, I am happy and that is why I like eating at home more than eating at a food stand or in a restaurant.

Is the sentence below written in the active voice or passive voice?
Pacha was given a cherry tree to plant in his garden.

Answers

the answer is passive
It is written in a passive voice

List the subject and verb in this sentence. You woke up late this morning ​

Answers

Answer:

'You' is the subject. 'woke up' is the verb.

what is the main idea of this passage?

Answers

Answer:

Since there is no passage provided here is the definition of a main idea

Explanation:

The main idea of a passage is the central idea or most important part of a paragraph.It is usually identified as the larger part of the passage

Hope this helps

Dont forget to smash that heart at the bottom <3

Plz Mark Brainliest

Have a great day!

PLEASE HELP MEDICAL TERM..

Answers

Answer:

missing opportunities for new, better approaches ⇒ over-reliance on past experience

making a poor decision based on incorrect data ⇒ not gathering enough pertinent information

taking too long to make a decision ⇒ fear of making independent decisions

Which of the following words best describes the emotional state depicted in the drawing? a. angry b. sad c. smug d. shocked

Answers

Answer:

bro we need the picture or we can't answer

Answer:

you didn't upload the file

A character battling the elements is a


character vs. self conflict.

character vs. nature conflict.

character vs. society conflict.

character vs. character conflict.

Answers

Answer:

Character vs Nature

Explanation:

The elements are a part of nature, therefore they are battling nature. Hope this helps :)

Can ……outside?

Children play

Children plays play children

Answers

Answer:

Can children play outside ?

Answer:

I believe it's can children play outside

Explanation:

It sounds most clear rather then the other ones

Which are the three required parts of a text ad?

Answers

Answer:

1. headline text

2. a display URL

3. description text

Explanation:

drought (drout) n. 1. a long period of lack of rain 2. a serious shortage A. adjective B. noun C. adverb D. preposition

Answers

Answer:

I think it's a long period of lack of rain

What is the mood is "aunty misery"

Answers

Answer:

Third, both “The Monkey's Paw and “Aunty Misery” convey the moral that fate should not be changed, for it brings only horrible consequences with it. The life lesson that “The Monkey's Paw” conveys is that destiny should not be interfered with.

Answer: mood aunty

Explanation:

so aunty is big in chemestry

Which of the following is associated with Wernicke's area?
Multiple Choice
Language innovation
Language production
Language intonation
Language comprehension

Answers

Language comprehension

The idea of the Wernicke's area was developed by Carl Wernicke.The language issue that is associated with Wernicke's are is;

Language comprehension

The Wernicke's area is located in the left hemisphere of the brain. It is located in the third posterior region of the upper temporal convolution.

Someone who has the is area disrupted for any reason can suffer from Wernicke's aphasia. In this condition, they are fluent in speech but forms words that do not make sense.

Summarily, Wernicke's area is associated with Language comprehension.

Learn more here:

https://brainly.com/question/24552101

Which central idea does Emerson develop in "Self-Reliance"?
OTo live authentic lives, people should practice nonconformity.

O To improve oneself, it is necessary to consider others' viewpoints.

O People who openly share their opinions are most respected in society.

O Fate is predetermined so there is little value in trying to change.

Part B
Which detail from the text best reflects the development of the central idea in Part A?
o "In every work of genius we recognize our own rejected thoughts..."

o "Accept the place the divine providence has found for you..."

o "Speak your latent conviction, and it shall be the universal sense..."

o "Insist on yourself, never imitate."

Answers

Part A:

The central idea developed by Emerson in "Self-Reliance" is A. To live authentic lives, people should practice nonconformity.

 

According to Ralph Waldo Emerson, nonconformity means relying on self-judgment, self-choices, and enjoying freedom from institutional and societal influences.

 

Self-reliance should triumph over every pursuit and can only be enjoyed by one who listens to their inner voice without allowing the world to quench the essence of the message.

 

Part B:

The detail from the text that best reflects the central idea in Part A is D. "Insist on yourself, never imitate," in the words of Emerson.

 

For Emerson, one who imitates makes a caricature of himself and does not value his self-worth. Emerson insists that everybody should highly rate their unique gifts and make something great out of them.

 

Thus, for Emerson, a nonconformist is what every achiever should be.

Read more about Emerson's Self-Reliance at https://brainly.com/question/6906114

Answer:

Explanation:

I took the test :)

are the phrases "this is interesting to do" and "doing this interests me" and "I am interested in doing this" the same

Answers

Answer:

Yes, they mean the same. These sentences are just different ways to say that something is interesting to you.

Hope this helps!!

From ED Galaxy What can the reader infer based on the interaction between maddox and Colton

Answers

Answer:

ok

Explanation:

too hard see

Why are most natural monopolies established?
O A. To earn maximum profits for shareholders
O B. To increase competition in a struggling industry
O C. To help governments provide public services
O D. To let companies avoid taxes and regulations
**Economics**

Answers

Answer:

D is the answer u understand

Natural monopolies are established to help governments provide public services. Hence, the correct answer is C.

What are natural monopolies?

Natural monopolies are industries where a single firm can produce at a lower cost than any potential competitor due to economies of scale. This means that as the firm produces more, the cost per unit decreases. Consequently, it becomes more cost-effective for a single company to provide the service rather than having multiple companies each producing a fraction of the output.

Most natural monopolies are established to help governments provide public services. The government may find it more efficient to have a single provider of the service, such as water or electricity, rather than having multiple providers. By doing so, the government can ensure that the services are provided at a reasonable cost and with an adequate level of quality.

Therefore, natural monopolies are established to help governments provide public services.

Learn more about natural monopolies, here:

https://brainly.com/question/29765560

#SPJ7

Other Questions
Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 1. Three fluids are poured from a beaker onto a lab table. Fluid A hits the table in 10 seconds, fluid B in 12 seconds, fluid C in 4 seconds, and fluid Din 15 seconds. Which fluid has the highest viscosity?O a fluid AO b. fluid BO c. fluid cO d. fluid D Which of the following is the correct definition for the term phrasal adverb?A. One or more adjectives in sequence that modify the same nounB. A phrase that functions as a unit to modify a nounC. Two or more words that function together as an adverbD. A single word that qualifies a single part of speech