Use the box method to distribute and simplify (-2x-6)(-4x - 1). Drag and
drop the terms to the correct locations of the table.
(-2x-6) (-4x-1)

Answers

Answer 1

Answer:69x-44

Step-by-step explanation:

69-44=67

Answer 2
Answer: 8x^2+26x+6

For the box method, you just multiply the numbers outside the box on the inside.

Hope this helps!
Use The Box Method To Distribute And Simplify (-2x-6)(-4x - 1). Drag Anddrop The Terms To The Correct

Related Questions

Please help! asap! (any accounts that give links will be reported)



⊙O and ⊙P are given with centers (−2, 7) and (12, −1) and radii of lengths 5 and 12, respectively. Using similarity transformations on ⊙O, prove that ⊙O and ⊙P are similar. Explain

Answers

We have shown that ⊙O and ⊙P are similar using similarity transformations.

To prove that ⊙O and ⊙P are similar using similarity transformations, we need to show that they have the same shape . Let's consider a dilation transformation with a scale factor of 2, centered at point A, which is the midpoint of the line segment connecting the centers of ⊙O and ⊙P:

1.Draw a line segment connecting the centers of ⊙O and ⊙P, and label the midpoint of this line segment as point A.

2.Draw two radii from the centers of ⊙O and ⊙P to a point B on the circumference of ⊙O, and label the intersection point of AB and ⊙P as point C.

3.Draw a perpendicular line from point A to BC, and label the intersection point as point D.

4.Since AD is the perpendicular bisector of BC, we have BD = DC.

5.By the properties of dilation, the length of any line segment on ⊙O is doubled when it is transformed by a dilation with a scale factor of 2 centered at A.

6.Therefore, the length of BD is doubled to become BE, and the length of DC is doubled to become CF.

7.Since ⊙O is transformed to a circle with center A and radius 10, and ⊙P is transformed to a circle with center A and radius 24, we can see that they have the same shape but different sizes.

Therefore, we have shown that ⊙O and ⊙P are similar using similarity transformations.

To know more about transformations refer here:

https://brainly.com/question/11707730

#SPJ11

Use undetermined coefficients to solve the nonhomogeneous equation


y″+11y′+28y=e^(5x)+x+4


a) write the characteristic equation of the associated homogeneous part by using the variable .

b) write the solution the associated homogeneous part, by using arbitrary constants 1 and 2 for 1 and 2. (note that: the order of the solutions are very important. you should write first 1 such that 1(−1/4)= and second 2 such that 2(−1/7)=.)


c) write the form of the any particular solution (we are using ,, etc. for undetermined coefficients for the correspoding functions in in the same order.):

and evaluate its derivatives and then found ″

d) thus evaluate the undetermined coefficients

e) finally write the general solution y=

Answers

a) The characteristic equation is r^2 + 11r + 28 = 0.

b) The associated homogeneous equation are y1(x) = c1e^(-4x) and y2(x) = c2e^(-7x).

c) The form of the particular solution is y_p(x) = Ae^(5x) + Bx + C.

d) By solving the system of equations, it gives A = 1/28, B = 1/28, and C = -211/196.

e) The general solution is y(x) = c1e^(-4x) + c2e^(-7x) + (1/28)e^(5x) + (1/28)x - 211/196.

a) The characteristic equation of the associated homogeneous equation is r^2 + 11r + 28 = 0.

b) Factoring the characteristic equation gives (r + 4)(r + 7) = 0, so the solutions to the associated homogeneous equation are y1(x) = c1e^(-4x) and y2(x) = c2e^(-7x).

c) The form of the particular solution is y_p(x) = Ae^(5x) + Bx + C. Taking the first and second derivatives of y_p(x) gives y_p'(x) = 5A + B and y_p''(x) = 0.

d) Substituting y_p(x), y_p'(x), and y_p''(x) into the original nonhomogeneous equation gives:

0 + 11(5A + B) + 28(Ae^(5x) + Bx + C) = e^(5x) + x + 4

Simplifying this equation gives:

(28A)e^(5x) + (28B)x + 11(5A) + 11B + 28C = e^(5x) + x + 4

Comparing coefficients gives the system of equations:

28A = 1

28B = 1

11(5A) + 11B + 28C = 4

Solving this system of equations gives A = 1/28, B = 1/28, and C = -211/196.

e) The general solution to the nonhomogeneous equation is y(x) = y_h(x) + y_p(x), where y_h(x) = c1e^(-4x) + c2e^(-7x) and y_p(x) = (1/28)e^(5x) + (1/28)x - 211/196. Therefore, the general solution is:

y(x) = c1e^(-4x) + c2e^(-7x) + (1/28)e^(5x) + (1/28)x - 211/196.

Learn more about "general solution":

https://brainly.com/question/30285644

#SPJ11

4/625 x 625/9 cross cancellation

Answers

Answer:

Step-by-step explanation:

4/625 x 625/9 = 4 x 1 / 5 x 5 x 5 x 1 = 4/625. The cross cancellation did not change the result.

Which linear equation represents a relation that is NOT a function? y = 3x +6 y = 9 −4y + 5x = 20 x = 7

Answers

Answer:

x = 7 is not a function--it is a vertical line.

The diagram below shows a quadratic curve. Determine the equation of the curve, giving your answer in the form ax²+bx+c y = = 03 where a, b and care integers. y i 32 (2.0) (8.0)​

Answers

Answer:

Step-by-step explanation:

Without a diagram, I cannot determine the equation of the curve. However, I can provide you with the general steps to find the equation of a quadratic curve given three points on the curve.

Let the three points be (x1, y1), (x2, y2), and (x3, y3). Then the equation of the quadratic curve in the form ax²+bx+c can be found using the following system of equations:

y1 = a(x1)² + b(x1) + c

y2 = a(x2)² + b(x2) + c

y3 = a(x3)² + b(x3) + c

Solving this system of equations simultaneously will give us the values of a, b, and c, which we can use to write the equation of the quadratic curve.

However, since you have only provided three y-values (32, 2.0, and 8.0), without their corresponding x-values or the diagram, it is not possible to determine the equation of the curve.

I need help on the quesrion attached

Answers

A simplification of the expression [tex]\frac{x^3y^3 \cdot x^3 }{4x^2}[/tex] is [tex]\frac{x^4y^3 }{4}[/tex].

What is an exponent?

In Mathematics, an exponent is a mathematical operation that is commonly used in conjunction with an algebraic equation or expression, in order to raise a given quantity to the power of another.

Mathematically, an exponent can be represented or modeled by this mathematical expression;

bⁿ

Where:

the variables b and n are numbers (numerical values), letters, or an algebraic expression.n is known as a superscript or power.

By applying the division and multiplication law of exponents for powers of the same base to the given algebraic expression, we have the following:

[tex]\frac{x^3y^3 \cdot x^3 }{4x^2}=\frac{x^{3+3-2}y^3 }{4}\\\\\frac{x^{3+3-2}y^3 }{4}=\frac{x^4y^3 }{4}[/tex]

Read more on exponent here: brainly.com/question/27858496

#SPJ1

Complete Question;

Simplify each of the expressions given.

20 points for this IF RIGHT ANSWER

Answers

The surface area of the solids are listed below:

Case 1: A = 366 mm²

Case 2: A = 448 cm²

Case 3: A = 748 m²

Case 4: A = 221.5 in²

Case 5: A = 692 in²

Case 6: A = 276 ft²

How to determine the surface area of a solid

In this question we need to determine the surface area of six solids, that is, the sum of areas of all faces in each solid. The solids can include areas of rectangles and triangles, whose formulas are:

Rectangle

A = b · h

Triangle

A = 0.5 · b · h

Where:

A - Area of the face.b - Base of the face.h - Height of the face.

Case 1

A = 2 · (13 mm) · (3 mm) + 2 · (13 mm) · (9 mm) + 2 · (9 mm) · (3 mm)

A = 78 mm² + 234 mm² + 54 mm²

A = 366 mm²

Case 2

A = 2 · (20 cm) · (6 cm) + 2 · (4 cm) · (6 cm) + 2 · (20 cm) · (4 cm)

A = 240 cm² + 48 cm² + 160 cm²

A = 448 cm²

Case 3

A = 2 · (5 m) · (14 m) + 2 · (16 m) · (14 m) + 2 · (5 m) · (16 m)

A = 748 m²

Case 4

A = 2 · (2 in) · (6.5 in) + 2 · (11.5 in) · (6.5 in) + 2 · (11.5 in) · (2 in)

A = 221.5 in²

Case 5

A = 2 · 0.5 · (12 in) · (7 in) + (11 in) · (19 in) + (9 in) · (19 in) + (12 in) · (19 in)

A = 692 in²

Case 6

A = 2 · 0.5 · (8 ft) · (3 ft) + 2 · (5 ft) · (14 ft) + (8 ft) · (14 ft)

A = 276 ft²

To learn more on surface areas of solids: https://brainly.com/question/31126484

#SPJ1

Answer: Goofy Ahh

Step-by-step explanation:

That question is so Goofy Ahh

Weeee

Can please write answer in box Please Thank you
Find the total differential. w = x15yz11 + sin(yz) = dw =

Answers

The total differential of w is given by dw = (∂w/∂x)dx + (∂w/∂y)dy + (∂w/∂z)dz + (∂w/∂z)(∂z/∂y)dy + (∂w/∂z)(∂z/∂z)dz.

Differentiation is a process of finding the changes in any function with a small change in By differentiation, it can be checked that how much a function changes and it also shows the way of change Differentiation is being used cost, production and other management decisions. It gives the rate of change independent variable with respect to the independent variable.                                                                                                             First, let's get the partial derivatives of w with respect to x, y, and z: ∂w/∂x = 15x^14yz^11, ∂w/∂y = x^15z^11cos(yz), ∂w/∂z = 11x^15y^z^10 + x^15y^11cos(yz). Next, we need to find (∂w/∂z)(∂z/∂y): ∂z/∂y = cos(y)
So, (∂w/∂z)(∂z/∂y) = x^15y^11z^10cos(y). Substituting these values into the formula for the total differential, we get: dw = (15x^14yz^11)dx + (x^15z^11cos(yz))dy + (11x^15y^z^10 + x^15y^11cos(yz))dz + (x^15y^11z^10cos(y))dy
Simplifying, we get: dw = 15x^14yz^11dx + x^15z^11cos(yz)dy + (11x^15y^z^10 + x^15y^11cos(yz) + x^15y^11z^10cos(y))dz.

Learn more about total differential here, https://brainly.com/question/28099315

#SPJ11

Determine the measure of arc cad thanks grade 9-10-11 it is either 240 or 260

Answers

The measure of arc CAD is either 240 or 260.

How to do measure of arc?

Without additional information, it is not possible to determine the measure of arc CAD with certainty. The measure of an arc depends on the central angle that subtends it.

If the central angle is known, the measure of the arc can be calculated using the formula: measure of arc = (central angle / 360) x circumference of the circle. However, without knowing the central angle, we cannot determine the measure of arc CAD.

Therefore, we need to be provided with additional information such as the measure of another angle that is related to the central angle, or the length of a chord that subtends the arc in order to determine the central angle and the measure of arc CAD.

Learn more about measure

brainly.com/question/4725561

#SPJ11

How to work out the size of angle x with 35° degrees only

Answers

Answer:

Step-by-step explanation:

33

In a box of nerds candy, the ratio of pink to purple candies is 19:20. if there are 429 pieces of candy in the box, how many are pink?

Answers

There are 199 pink candies in the box of Nerds calculated on the basis of given information.

To find out, you first need to add the ratio of pink and purple candies, which is 19+20=39. Then, divide the total number of candies by the sum of the ratio to find the value of one unit of the ratio, which is 429/39 = 11.

Then, multiply the value of one unit of the ratio by the value of the pink candies, which is 19, to find the number of pink candies, which is 11 x 19 = 209. Therefore, there are 209 purple candies in the box.

For more questions like Candies click the link below:

https://brainly.com/question/22074890

#SPJ11

Can someone help me I'm stuck.

Alexandria rolled a number cube 60 times and recorded her results in the table.

What is the theoretical probability of rolling a one or two? Leave as a fraction in simplest from​

Answers

The theoretical probability of rolling a one or two on a number cube is 2/5 or 0.4.

To find the theoretical probability of rolling a one or two on a number cube, we need to determine the number of outcomes that correspond to rolling a one or two, and divide that by the total number of possible outcomes.

From the table, we can see that Alexandria rolled a one or two a total of 24 times out of 60 rolls. This means that the probability of rolling a one or two is: P(1 or 2) = 24/60

Simplifying the fraction by dividing both the numerator and denominator by the greatest common factor, we get: P(1 or 2) = 4/10

This can be further reduced to: P(1 or 2) = 2/5

Therefore, the theoretical probability of rolling a one or two on a number cube is 2/5 or 0.4.

In summary, the theoretical probability is the expected probability of an event occurring, based on mathematical reasoning. Here, we used the number of favorable outcomes to calculate the probability of rolling a one or two, and expressed the answer as a fraction in simplest form.

To know more about theoretical probability, refer here:

https://brainly.com/question/31264350#

#SPJ11

Beatrice used a slingshot to launch an egg into the air. She recorded the egg’s path using a motion detector. The following data represents the height (in feet) of the egg at certain time points (in seconds): { ( 0.0 , 16 ) , ( 1.7 , 20.46 ) , ( 2.5 , 23.16 ) , ( 3.7 , 23.51 ) , ( 5.1 , 20.07 ) , ( 6.6 , 12.4 ) , ( 7.3 , 5.62 ) , ( 8.0 , 0.15 ) }

Step 4: Determine the height from which the egg was launched.
8 feet
3 feet
16 feet
0 feet

Answers

Answer:

mmm, well, not much we can do per se, you'd need to use a calculator.

I'd like to point out you'd need a calculator that has regression features, namely something like a TI83 or TI83+ or higher.

That said, you can find online calculators with "quadratic regression" features, which is what this, all you do is enter the value pairs in it, to get the equation.

Step-by-step explanation:

A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenth

PLEASE HURRY

Answers

the volume of each souvenir is  43. 85 cm³

How to determine the volume

The formula for calculating the volume of a cone is represented as;

V = 1/3 πr²h

Given that;

V is the volumer is the radius of the coneh is the height of the cone

Then,

r = diameter/2 = 4.2 /2 = 2.1 centimeters

Substitute the values, we have

Volume = 1/3  × 3.14 × 2.1² × 9.5

find the square, we have;

Volume = 1/3 × 3.14 × 4. 41 × 9.5

Multiply the values

Volume = 131. 5503/3

divide the values

Volume = 43. 85 cm³

Learn about cones at: https://brainly.com/question/6613758

#SPJ1

A foam cylinder, with a diameter of 3 inches and height of 4 inches, is carved into the shape of a cone. what is the


maximum volume of a cone that can be carved? round your answer to the hundredths place.

Answers

The maximum volume of a cone that can be carved from the foam cylinder is approximately 9.42 cubic inches.

Given data:

diameter = 3 inches

radius = r = 3 ÷ 2 = 1.5 inches

height = 4 inches

We need to find the maximum volume of a cone that can be carved from the foam cylinder. The volume of a cone is given by the formula:

V = [tex]\frac{1}{3}\pi r^2h[/tex]

where:

V = volume

r = radius of the base

h = height

π = 3.14.

Substituting the r, h, and  π values in the formula, we get:

V = [tex]\frac{1}{3}[/tex]π[tex]r^2[/tex]h

V = [tex]\frac{1}{3}[/tex] × π × (1.5)² ×(4)

V =  [tex]\frac{1}{3}[/tex] × π × 2.25 ×(4)

V = 3 π

V = 9.42 cubic inches

Therefore, the maximum volume of a cone is 9.42 cubic inches.

To learn more about the volume of a cone:

brainly.com/question/31211180

#SPJ4

If f(x) = x2 + 4x + 6, find the following values. = 1. f(a) = 2. f(a - 1) = 3. f(a + 1) =

Answers

To find the values of f(a), f(a-1), and f(a+1) when f(x) = x^2 + 4x + 6, So, the values are:  f(a) = a^2 + 4a + 6, f(a-1) = a^2 + 6a + 3, f(a+1) = a^2 + 6a + 11.

we simply substitute the given values of a into the function.
1. f(a) = a^2 + 4a + 6
2. f(a-1) = (a-1)^2 + 4(a-1) + 6 = a^2 + 2a + 1 + 4a - 4 + 6 = a^2 + 6a + 3
3. f(a+1) = (a+1)^2 + 4(a+1) + 6 = a^2 + 2a + 1 + 4a + 4 + 6 = a^2 + 6a + 11
So, the values are:
1. f(a) = a^2 + 4a + 6
2. f(a-1) = a^2 + 6a + 3
3. f(a+1) = a^2 + 6a + 11

Visit here to know more about values:

brainly.com/question/30145972

#SPJ11

The first number is 30% less than the second number and the third number is 40% more than the second number.What is the ratio of the first number to the third number?

Answers

Let's assume the second number to be 'x'.

According to the problem, the first number is 30% less than the second number.

This means the first number will be (1-30/100)x = 0.7x

Similarly, the third number is 40% more than the second number.

This means the third number will be (1+40/100)x = 1.4x

Now, we are asked to find the ratio of the first number to the third number:

Ratio of the first number to the third number = 0.7x/1.4x

Ratio of the first number to the third number = 1/2

Therefore, the ratio of the first number to the third number is 1:2.
Let second number be x

First number Is 30% less than 2nd number. Therefore the 1st number is = 70%x = 0.7x

3rd number. is 40% more than 2nd number. Therefore
3rd number.= x + 40%x = x+0.4x = 1.4x

The required ratio of 3rd and 1st number. is 1.4x/0.7x = 1.4/0.7= 2/1.

Required ratio of 1st :3rd number = 1:2

Thr ratio of measures of the angle is ABC IS 4:13:19. Find the measure of the angle. This is geometry

Answers

The measure of angle A is 20 degrees, the measure of angle B is 65 degrees, and the measure of angle C is 95 degrees.

To find the measure of the angles in triangle ABC, we first need to determine the total ratio of measures.

The total ratio is 4 + 13 + 19 = 36.

Next, we can use the ratios to find the measure of each angle.

Let x be the measure of the smallest angle in triangle ABC.

Then the measures of the angles are:

Angle A = 4x
Angle B = 13x
Angle C = 19x

We know that the sum of the angles in a triangle is 180 degrees, so we can set up the equation:

4x + 13x + 19x = 180

Simplifying, we get:

36x = 180

Dividing both sides by 36, we get:

x = 5

Therefore, the measures of the angles in triangle ABC are:

Angle A = 4x = 4(5) = 20 degrees
Angle B = 13x = 13(5) = 65 degrees
Angle C = 19x = 19(5) = 95 degrees

To learn more about angles

https://brainly.com/question/1309590

#SPJ11

true or false, Inflation occurs in an economy when there's a reduction in the total amount of money.

Answers

Answer:

False.

Inflation occurs in an economy when there is an increase in the overall price level of goods and services over time. It is usually caused by factors such as an increase in the money supply, higher demand for goods and services, or a decrease in the supply of goods and services. Therefore, a reduction in the total amount of money in an economy would generally lead to deflation, which is the opposite of inflation.

how many times does five go into 6

Answers

Answer:

1 time, though your answer would be ongoing. If you the actual answer, it's 1.2

Step-by-step explanation:

Round to the nearest tenth.

Answer:

1.2

Step-by-step explanation:

Five can go into six 1.2 times because (1.2)(5)=6. Of course, if you want to know how many times five can go into 6 as a WHOLE, then the answer would obviously be 1.

Hope this helps a bit :)

Consider the function f(x,y) = 4x^4 - 4x^²y + y^2 + 9 and the point P(-1,1). a. Find the unit vectors that give the direction of steepest ascent and steepest descent at P. b. Find a vector that points in a direction of no change in the function at P.

Answers

The unit vector in the direction of steepest ascent at P is <-4/sqrt(17), -1/sqrt(17)>,  and the unit vector in the direction of steepest descent at P is <4/sqrt(17), 1/sqrt(17)>.  A vector that points in a direction of no change at P is ⟨-1,1⟩.

To find the direction of steepest ascent/descent at P(-1,1) for f(x,y) = 4x^4 - 4x^2y + y^2 + 9, we need to find the gradient vector evaluated at P and then normalize it to get a unit vector. The gradient vector is given by

grad f(x,y) = <∂f/∂x, ∂f/∂y> = <16x^3 - 8xy, -4x^2 + 2y>

So, at P(-1,1), the gradient vector is

grad f(-1,1) = <16(-1)^3 - 8(-1)(1), -4(-1)^2 + 2(1)> = <-8,-2>

To find the unit vector that gives the direction of steepest ascent, we normalize the gradient vector

||grad f(-1,1)|| = sqrt[(-8)^2 + (-2)^2] = sqrt(68)

So, the unit vector in the direction of steepest ascent at P is

u = (1/sqrt(68))<-8,-2> = <-4/sqrt(17), -1/sqrt(17)>

To find the unit vector that gives the direction of steepest descent, we take the negative of the gradient vector and normalize it

||-grad f(-1,1)|| = ||<8,2>|| = sqrt[8^2 + 2^2] = sqrt(68)

So, the unit vector in the direction of steepest descent at P is

v = (1/sqrt(68))<8,2> = <4/sqrt(17), 1/sqrt(17)>

To find a vector that points in a direction of no change in the function at P, we need to find a vector orthogonal to the gradient vector at P. One such vector is

n = <2,-8>

To see why this works, note that the dot product of the gradient vector and n is

<16x^3 - 8xy, -4x^2 + 2y> . <2,-8> = 32x^3 - 16xy - 4x^2y + 2y^2

Evaluating this at P(-1,1), we get

32(-1)^3 - 16(-1)(1) - 4(-1)^2(1) + 2(1)^2 = 0

So, the vector n is orthogonal to the gradient vector at P and points in a direction of no change in the function.

To know more about unit vectors:

https://brainly.com/question/30279109

#SPJ4

A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the​ sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is​ mounted

Answers

Answer:

Step-by-step explanation:

We can use the Pythagorean theorem to solve this problem. Let's call the length of the ladder "L". The ladder, the wall of the house, and the ground form a right triangle. The distance between the ladder and the house is the base of the triangle, which is 15 feet. The height of the triangle is the distance from the ground to the spotlight, which is 20 feet. The length of the ladder is the hypotenuse of the triangle.

Using the Pythagorean theorem, we have:

L^2 = 15^2 + 20^2

L^2 = 225 + 400

L^2 = 625

L = sqrt(625)

L = 25

Therefore, a ladder of at least 25 feet is needed for the electrician to reach the place where the light is mounted.

Find the error & explain why it is wrong:
megan solved the following problem. what did she do wrong?
what is (f - g)(2)?
f(x) = 3x2 – 2x + 4
g(x) = x2 – 5x + 2

Answers

The value of (f-g)(2) is 16, provided that Megan has made no mistakes in the calculation.

Find the error in the given problem solved by Megan?

The problem asks us to compute the value of (f - g)(2) where f(x) = 3x^2 - 2x + 4 and g(x) = x^2 - 5x + 2.

The notation (f - g)(2) means that we need to subtract g(x) from f(x) and then evaluate the result at x = 2. We can do this as follows:

(f - g)(x) = f(x) - g(x) = (3x^2 - 2x + 4) - (x^2 - 5x + 2) = 2x^2 + 3x + 2

Substituting x = 2, we get:

(f - g)(2) = 2(2)^2 + 3(2) + 2 = 16

Therefore, the value of (f - g)(2) is 16.

It's worth noting that the problem statement mentions "what did she do wrong?" without providing any context or information about what Megan did or didn't do. So, it's not possible to identify any error in Megan's solution based on the given information. However, based on the correct computation above, we can be sure that (f - g)(2) is indeed equal to 16.

In other words, it can be described as,

The error in Megan's solution is not clear from the given statement. However, it seems that she may have made an error while computing (f-g)(2).

To compute (f-g)(2), we need to subtract g(2) from f(2) as follows:

f(2) = 3(2)^2 - 2(2) + 4 = 12

g(2) = (2)^2 - 5(2) + 2 = -4

Therefore, (f-g)(2) = f(2) - g(2) = 12 - (-4) = 16. is the final conclusion.

Learn more about Solution

brainly.com/question/30198131

#SPJ11

A buoy is floating in the water near a lighthouse. The height of the lighthouse is 18 meters, and the horizontal distance from the buoy to the base of the lighthouse is 45 meters. What is the approximate angle of elevation from the buoy to the top of the lighthouse, rounded to the nearest whole degree?

Answers

The equivalent expression is $\boxed{4^{15} \cdot 5^{10}}$.

Find out the simplified expression inside the parentheses?

We can simplify the expression inside the parentheses first, using the rule that says when you raise a power to another power, you multiply the exponents:

$\left(\dfrac{4^{3}}{5^{-2}}\right)^{5} = \left(4^{3} \cdot 5^{2}\right)^{5}$

Now, we can use the rule that says when you raise a product to a power, you raise each factor to the power:

$\left(4^{3} \cdot 5^{2}\right)^{5} = 4^{3 \cdot 5} \cdot 5^{2 \cdot 5}$

Simplifying further:

$4^{3 \cdot 5} \cdot 5^{2 \cdot 5} = 4^{15} \cdot 5^{10}$

we can substitute this expression back into the original expression:

$\left(\dfrac{4^{3}}{5^{-2}}\right)^{5} = \left(4^{3} \cdot 5^{2}\right)^{5}$

To simplify this expression further, we can use the rule that says when you raise a product to a power, you raise each factor to the power:

$\left(4^{3} \cdot 5^{2}\right)^{5} = 4^{3 \cdot 5} \cdot 5^{2 \cdot 5}$

Simplifying the exponents, we get:

$4^{3 \cdot 5} \cdot 5^{2 \cdot 5} = 4^{15} \cdot 5^{10}$

Learn more about Angles

https://brainly.com/question/26111088

#SPJ11

ASAP THX!!! ANSWER GETS BRAINLIEST

Rachel went to the grocery store and spent $68. She now has only $23 to get gasoline with before she returns home. How much money did Rachel have before she went grocery shopping? Create an equation to represent the situation. Make sure to identify and label your variable. Solve for the variable and describe your answer. Show your work and prove your solution to be correct

Answers

The solution is correct, as both sides of the equation are equal.

To find out how much money Rachel had before she went grocery shopping, we can create an equation using a variable.

Let x represent the amount of money Rachel had before grocery shopping.

The equation for the situation would be: x - $68 = $23

Now, let's solve for x:
Step 1: Add $68 to both sides of the equation:
x = $23 + $68

Step 2: Calculate the sum:
x = $91

So, Rachel had $91 before she went grocery shopping.

To prove the solution is correct, we can plug the value of x back into the equation:
$91 - $68 = $23
$23 = $23

Hence, both are equal.

To learn more about Variables

https://brainly.com/question/28248724

#SPJ11

Find the Differentials of
1) z = x^2 - xy^2 + 4y^5
2) f(x,y) = (3x-y)/(x+2y)
3) f(x,y) = xe^x3y

Answers

1) To find the differentials of z = x^2 - xy^2 + 4y^5, we can use the total differential formula:

dz = (∂z/∂x)dx + (∂z/∂y)dy

Taking the partial derivatives of z with respect to x and y:

∂z/∂x = 2x - y^2

∂z/∂y = -2xy + 20y^4

Substituting these into the total differential formula:

dz = (2x - y^2)dx + (-2xy + 20y^4)dy

2) To find the differentials of f(x,y) = (3x-y)/(x+2y), we can again use the total differential formula:

df = (∂f/∂x)dx + (∂f/∂y)dy

Taking the partial derivatives of f with respect to x and y:

∂f/∂x = (y-3)/(x+2y)^2

∂f/∂y = (3x-2y)/(x+2y)^2

Substituting these into the total differential formula:

df = [(y-3)/(x+2y)^2]dx + [(3x-2y)/(x+2y)^2]dy

3) To find the differentials of f(x,y) = xe^x3y, we can once again use the total differential formula:

df = (∂f/∂x)dx + (∂f/∂y)dy

Taking the partial derivatives of f with respect to x and y:

∂f/∂x = e^(x3y) + 3xye^(x3y)

∂f/∂y = 3x^2e^(x3y)

Substituting these into the total differential formula:

df = (e^(x3y) + 3xye^(x3y))dx + (3x^2e^(x3y))dy

Here are the results:

1) For z = x^2 - xy^2 + 4y^5, the partial derivatives are:
∂z/∂x = 2x - y^2
∂z/∂y = -2xy + 20y^4

2) For f(x,y) = (3x-y)/(x+2y), the partial derivatives are:
∂f/∂x = (3(x+2y) - 3(3x-y))/(x+2y)^2
∂f/∂y = (-1(x+2y) + (x+2y))/(x+2y)^2

3) For f(x,y) = xe^(x^3y), the partial derivatives are:
∂f/∂x = e^(x^3y) * (1 + 3x^2y)
∂f/∂y = xe^(x^3y) * x^3

These partial derivatives represent the differentials for each respective function.

Learn more about Differentials here: brainly.com/question/24898810

#SPJ11

4x - 2y = -1
8x - 4y = -2
what method is most efficient to use and what is the answer

Answers

Elimination is most efficient to use

x and y have infinite solution

First, we will solve one equation for one variable in terms of the other variable. Let's solve the first equation for y in terms of x:

4x - 2y = -1

-2y = -4x - 1

y = 2x + 1/2

Now we can substitute this expression for y into the second equation:

8x - 4y = -2

8x - 4(2x + 1/2) = -2

8x - 8x - 2 = -2

-2 = -2

This is a true statement, which means that the system of equations has infinitely many solutions. In other words, any value of x will satisfy the system of equations.

So the answer is that the system of equations has infinitely many solutions.

verify that the equation is an identity. 2cosx2x/sin2x=cotx-tanx

Answers

The LHS is equal to the RHS, and the given equation is verified as an identity. We have to verify that the following equation is an identity:

2cos(x) 2x / sin2(x) = cot(x) - tan(x)

Starting from the left-hand side (LHS):

2cos(x) 2x / sin2(x) = 2cos(x) 2x / (1 - cos2(x)) (using the identity sin2(x) = 1 - cos2(x))

= 2cos(x) 2x / (1 - cos(x)) (1 + cos(x))

= 2cos(x) 2x / (1 - cos(x)) (1 + cos(x)) (multiplying the denominator by (1 + cos(x)))

= 2cos(x) 2x / (1 - cos2(x))

= 2cos(x) 2x / sin2(x) (using the identity 1 - cos2(x) = sin2(x))

= 2cos(x) / sin(x) (simplifying by canceling out the common factor of 2 and cos(x))

= 2cos(x) / sin(x) * (cos(x) / cos(x)) (multiplying by 1 in the form of cos(x)/cos(x))

= 2cos2(x) / (sin(x)cos(x))

= 2cos(x)/sin(x) * cos(x)

= cot(x) * cos(x)

Now, moving to the right-hand side (RHS):

cot(x) - tan(x) = cos(x)/sin(x) - sin(x)/cos(x)

= cos2(x)/sin(x)cos(x) - sin2(x)/sin(x)cos(x)

= (cos2(x) - sin2(x))/sin(x)cos(x)

= cos(x)/sin(x) * cos(x)/cos(x) - sin(x)/cos(x) * sin(x)/sin(x) (using the identity cos2(x) - sin2(x) = cos(x)cos(x) - sin(x)sin(x))

= cot(x) * cos(x)

Therefore, the LHS is equal to the RHS, and the given equation is verified as an identity.

Learn more about LHS is equal to the RHS,

https://brainly.com/question/30298176

#SPJ4

Find the critical point and determine if the function is increasing or decreasing on the given intervals. y = x2 - 4x?, x>0 (Use decimal notation. Give your answer to three decimal places.) critical point c= _____

Answers

The critical point is c = 2, the function is decreasing on the interval 0 < x < 2, and increasing on the interval x > 2.

To find the critical point of the function y = x^2 - 4x, we first need to find its derivative, which represents the slope of the tangent line at any point on the curve.

The derivative of y with respect to x is:

y' = 2x - 4

Now, we need to find the critical points, which occur where the derivative is zero or undefined. In this case, the derivative is a polynomial, so it is never undefined. To find where it equals zero, we set y' equal to zero:

0 = 2x - 4

Solving for x, we get:

x = 4/2 = 2

So, the critical point is c = 2.

Now, we need to determine if the function is increasing or decreasing on the interval x > 0. To do this, we can analyze the sign of the derivative. If y' > 0, the function is increasing; if y' < 0, the function is decreasing.

For x > 2 (to the right of the critical point), the derivative y' = 2x - 4 is positive (since 2x > 4 when x > 2). Therefore, the function is increasing on the interval x > 2.

For x < 2 (to the left of the critical point), the derivative y' = 2x - 4 is negative (since 2x < 4 when x < 2). Therefore, the function is decreasing on the interval 0 < x < 2.

In summary, the critical point is c = 2, the function is decreasing on the interval 0 < x < 2, and increasing on the interval x > 2.

To learn more about critical point, refer below:

https://brainly.com/question/31017064

#SPJ11

Graph the points (–2.5,–3), (2.5,–4), and (5,0.5) on the coordinate plane.

Answers

The points are graphed on a coordinate plane and attached

What is a coordinate plane

A coordinate plane, also known as a Cartesian plane, is a two-dimensional plane with two perpendicular lines that intersect at a point called the origin.

The horizontal line is called the x-axis and the vertical line is called the y-axis. The axes divide the plane into four quadrants.

Each point on the plane can be uniquely identified by a pair of coordinates (x, y), where x is the horizontal distance from the origin along the x-axis and y is the vertical distance from the origin along the y-axis.

Learn more on coordinate plane

https://brainly.com/question/29765572

#SPJ1

Other Questions
Los principales componente del sistema linfatico para desarrollar la funcion immunologica son Which psychological disorder is this?Justice talks often about his success in school, athletics, & dating exploits. Justice often expects help from his friends when Justice needs it. However, when Justices friends need help he talks about how unimportant the friend's task is & how important his plans are and how he cant help. Justice is often heard proclaiming to the class how lucky his friends are to have him 16Which graph correctly represents the relationship between arc length and the measure of the corresponding central angle on a circle with radius r? .m. All rights reserved.2 FrArcLengthQ SearchI:3=IA>0 True or False Sociological perspective is basically being able to see the world through another person's eyes. Match each Native American tribe with the language family to which it belongs. Siouan Athabaskan Uto-AztecanTanouanKiowa ApacheOsageComanche KThis passage, Managing Speech Anxiety, is from a communications textbook.Review the passage as needed.wwwA. Although speech anxiety can be cured, most individuals with this condition are not sure where to fincprofessional help and treatment.B.Speech anxiety is a multisystem response; in this state, a combination of biochemical changes arereleased into the body whenever the person is placed in a stressful situation involving communicationOC. Symptoms of speech anxiety include a rapid heartbeat, an increase in blood pressure, and an overflowof adrenaline to other parts of the body.1Next Can someone help me I'm stuck. Alexandria rolled a number cube 60 times and recorded her results in the table. What is the theoretical probability of rolling a one or two? Leave as a fraction in simplest from A spotlight is mounted on the eaves of a house 20 feet above the ground. A flower bed runs between the house and the sidewalk, so the closest the ladder can be placed to the house is 15 feet. How long a ladder is needed so that an electrician can reach the place where the light is mounted If f(x) is defined as follows, find (a) f(-3), (b) f(0), and (c) f(4).xif x < 0if x = 03x + 3 ifx>0f(x) = 0(a) f(-3)= (Simplify your answer.)THE The operating system is not presently configured to run this application. A pressure switch is used in a washing machine to control the flow of water. The water pushes on a flexible container and compresses some trapped air. When the pressure of this trapped air reacher 104 kPa, the pressure switch turns the water off. The pressure of the trapped air is given by this relationship: pressure of the trapped air - atmospheric pressure + pressure difference caused by the water. Calculate the height of water in the machine when the pressurre of the trapped air reaches to 104 kPa and the switch operates. (atmospheric pressure = 100 kPa, density of water = 1000 kg/m^3) How to find out if a solid, more specifically powdered cement, is acid or alkali? Between 1940 and 1955, the average income for a u.s. family tripled. this was likely the result of- reduced unemployment - the expansion of corporations & creation of more white-collar jobs- all of these choices are correct- more women entering the workplace A car repair shop specialises in exhaust pipe replacement. Every year it costs $34,800 to rent the shop and maintain their equipment and $50,000 to pay their employees. For every exhaust pipe replaced the repair shop charges the customer the price of the parts required plus $248 as a service charge. How many exhaust pipe replacements does the repair shop need to complete in order to break even? 4. Calculate and properly express the 2017 accounts receivable turnover ratio for OReilly Auto Parts. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)8,977,726/216,251+197,274/2 = 8,977,726/206762.5 = 43.4 times Answer: 43.4 times5. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) accounts receivable turnover ratio for AutoZone. ASSUME ALL SALES REPRESENT CREDIT SALES. (6 pts)10,888,676/280,733+287,680/2 = 10,888,676/284206.5 = 38.3 timesAnswer: 38.3 times6. Calculate and properly express the average collection period for each company. (6 pts)OReilly Auto Parts: 365/43.4 = 8.4 daysAutoZone: 365/38.3 = 9.5 daysAnswer: OReilly Auto Parts: 8.4 daysAutoZone: 9.5 days7. Which company has a better receivable turnover ratio and why? Explain in three complete sentences. (4 pts)8. Calculate and properly express the 2017 inventory turnover ratio of OReilly Auto Parts. (6 pts)4,257,043/3,009,800+2778,976/2 = 4,257,043/2,894,388 = 1.5 timesAnswer: 1.5 times9. Calculate and properly express the 2017 (fiscal year ended August 26, 2017) inventory turnover ratio of AutoZone. (6 pts)5,149,056/3,882,086+3,631,916/2 = 1.4 timesAnswer: 1.4 times10. Calculate the average days to sell inventory for each company. (6 pts)OReilly Auto Parts: 365/1.5 = 243.3 daysAutoZone: 365/1.4 = 260.7 days Answer: OReilly Auto Parts: 243.3 daysAutoZone: 260.7 days11. Which company has a better inventory turnover ratio? (2 pts) Why, what does this ratio represent? Explain in a short paragraph. (4 pts)I need a answer for n 7 and 11 Which of the following examples of figurative language from the poem best supports the idea that Susan B. Anthony was ahead of her time?A.On ground hard held to the last, gaining her goal for womenB. Her life is a luminous banner bome ever ahead of her eraC. Her spirit like southern starlight at once is afar and around usD. In the mine, the mill and the mart where is bartered the bread of your children At what condition do magnesium chloride and silver nitrate react? this is due now !!!!!!!! 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC A museum sells stone souvenirs shaped like a cone with a diameter of 4.2 centimeters and a height of 9.5 centimeters. What is the volume of each souvenir? Round to the nearest tenthPLEASE HURRY