Using its long tail and long hind legs, the Ord's kangaroo rat can jump 2 m in the air as it hops away from predators, such as snakes and owls [A, 4 marks] a. How would Lamarck account for the origin of the long hind legs of the Ord's kangaroo rat? b. How would Darwin?

Answers

Answer 1

Answer and Explanation:

a. According to Lamarck, the origin of the long hind legs of the Ord's kangaroo rat is acquired due to extensive use of the muscle legs to jump. Such physical characteristics could be transmitted to future generations. This theory is called Neo-Lamarckism.

b. Darwin, on the other hand, theorized that in a population of Ord's kangaroo rat, there was an individual whose characteristics, long tail and hind legs, had more chances of escaping its predator and, consequently, could survive and reproduce. This theory is called Darwinism.


Related Questions

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)

Answers

Answer:

An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.

Hope this answered your question :)

I NEED HELP

1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?

Answers

Answer:

1. a chromosome is a dna strand that has genes

2. prophase, metaphase, anaphase, telophase

3. anaphase

4. the two nuclei are identical daughter cells and they have the same number of chromosomes

5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.

sorry if this is wrong but this is how i learned it! hope it helps!

Explanation:

The physical characteristics of an organism are its

Answers

Answer:

appearance, development, and behavior

Explanation:

The phenotype, similar to the genotype, can be observed in two senses: wider and narrower. In a broader sense, a phenotype is a set of all morphological and physiological properties by which an organism is recognized and by which it differs from other organisms.

When we look at only one trait, then it is the narrower meaning of the phenotype. What will be the influence of genotype on phenotype depends not only on the genetic basis but also on the action of environmental factors in which the organism develops.

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

One danger of excessive nitrogen levels in water is BLANK.

Answers

Answer:

light

Explanation:

excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each
energy level?

Answers

Sulfur has 16 electrons in its atoms. Over how many energy levels are the electrons distributed, and how many are in each energy level? The electrons in a sulfur atom are distributed over the three energy levels; there are two electrons in the first energy level, eight in the 2nd, and six in the third.

Attempt to

A

A

1

2

3

4

5

6

7

8

9

10

»

A century ago, swords were made from various metals, especially steel. The property that makes steel a good choice for

sword making is

tensile strength

ductility

strength

conductivity

NEXT QUESTION

READ NEXT SECTION

ASK FOR HELP

TURN IT IN

Answers

Answer:

The property that makes steel a good choice for sword-making is strength

Explanation:

The strength of a material is its ability to withstand an applied load or force without failure or plastic deformation.  Types of strength of materials include; tensile strength, yield strength, torsional strength, compressional strength, shear strength.

Tensile strength of material is the ability of that material to withstand any force that tends to break or tear it apart. It is calculated by dividing the maximum amount of load or force the material can carry or withstand without breaking by the surface area of the material.

Mathematically, Tensile strength = Force/area

Its unit is Newton per meter squared, N/m².

Yield Strength In Steel

Yield strength is the maximum stress that can be applied before it begins to change shape permanently. Yield strength represents the upper limit of the load that can be safely applied to the meta beyond which it shape deforms.

Steel is an alloy of iron and carbon. It has many important and desirable properties such as durability, hardness and conductivity, and high tensile strength. However, the high strength of steel made a good choice for sword-making in the ancient past and even in the present.

Many new reproductive strategies developed during the evolution of terrestrial vertebrates. Which statement identifies one of these new strategies? A. Eggs develop without fertilization B. Eggs develop outside of a parent's body C. Eggs are laid by the female parent only D. Fertilized eggs develop away from the body of water

Answers

Answer:

D

Explanation:

One of the reproductive strategies of terrestrial vertebrates is the ability of fertilized eggs to develop away from the body of water.

Water is very important for fertilization in aquatic organisms and one of the biggest challenges posed by migrating to the terrestrial environment is desiccation of the eggs. Terrestrial vertebrates are able to overcome these challenges by making fertilization of eggs internal and the ability of the fertilized eggs to develop away from the body of water.

The correct option is D.

Answer:

D. Fertilized eggs develop away from a body of water

Explanation:

Adaptations of plants in different climatic conditions in Telangana

Answers

Explanation:

Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.

Thus, plants in the Telangana region would usually possess  the following adaptive features;

ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?

A. 0%
B. 25%
C. 50%
D. 100%

Answers

Answer:

i think it may be 50 dont be mad if im wrong

Explanation:

recessive takes over from what i read i dont see any o so it can be half a half b so 50...

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

What purpose does xylem serve in trees?
Giving brainliest to first correct answer

Answers

Answer:

i think the life soucre

Explanation:

Answer:Xylem is the plant vascular tissue that conveys water and dissolved minerals from the roots of the plant to the rest of the trees for physical support. Basically provides the tree with a way to stand.

Explanation:hope that answer helped I tried<3

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

What is the nervous system and how does it help you function? What structures are included in the human nervous system?

Answers

The nervous system is the major controlling, regulatory, and communicating system in the bodyThe nervous system plays a role in nearly every aspect of our health and well-being. It guides everyday activities such as waking up; automatic activities such as breathing; and complex processes such as thinking, reading, remembering, and feeling emotionsThe nervous system has two main parts: The central nervous system is made up of the brain and spinal cord. The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think

This is a negative charge. On the left draw the type of charge that would move away from it. On the right, draw the
type of charge that would move towards it.
(This is science)

Answers

Answer:

On the left is negative charge while on the right is positive charge.

Explanation:

On the left, there should be negative charge that will move away due to repulsion force because both charges are same so they move away from one another while on the other hand, on the right side there should be positive charge which will move towards it because both charges are opposite to each other so they attract each other.

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

What role do currents play in rivers and streams?

Answers

Answer: A current, in a river or stream, is the flow of water influenced by gravity as the water moves downhill to reduce its potential energy. The current varies spatially as well as temporally within the stream, dependent upon the flow volume of water, stream gradient, and channel geometry.

Explanation:

Answer:

Currents help the water in rivers and streams flow downhill, with the ultimate goal of flowing into the oceans, which are at sea level.

Explanation:

got me a 100 on edge 2020

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

Other Questions
integrated programmes help to conserve environment give reason SOLVE FOR XX/3 + x-1/4 = 2+Xshow (or describe every step)the x-1/4 is ONE fraction, not a variable minus 1/4. Why were Africans enslaved and brought to the americas If p = 3sec theta and q= 3 tan^2 theta - 1, then find p-q. given: rectangle JKLMprove: JL = MK 1. Kathy's brothers played tennis all day.2. She and Karen cheered wildly during the game.B.The horses and the donkeys are kept in the stablesA lone pigeon stood at the top of the statue.Your mom or my dad will drive us to the movie theater.5. Aisha needs to be at least 48 inches tall to ride the colossal coaster at the amusement park. If she grows 5 inches during the next year, Aisha will still not be tall enough to ride. In the context of this situation, what does the inequality x less-than 43 represent? After next year, Aisha still needs to grow 43 more inches to ride. Aisha is less than 43 inches tall right now. Aisha needs to grow 43 more inches to ride. Aisha is at least 43 inches tall now. hello guys how is this pic. ....#love from india HELP ASAAAAAP EXPLAIIINNN WILL NAME BRAINLIESTThink about the difference between citizenship by birth and citizenship by naturalization. In your opinion, whomight value his citizenship more, the naturalized citizen of the citizen by birth? Write your answer to this question and your reasons in a two-page report. answer this pls pls pls pls pls This food stand claims that the $7.00 bucket of fries is the best buy Are they correct? *Unit Rates*16oz=$6.0032oz=$7.0088=$9.50 This is equations and graph. Please answer correctly :( Maria invests her $150 for 2 years at 4% per year compound interest.A) Calculate the exact amount Maria has at the end of 2 years.Maria continues to invest her money at 4% per year compound interest.After 20 years she has $328.67.i) Calculate exactly how much more this is than $150 invested for 20 years atsimple interest.(ii) Calculate $328.67 as a percentage of $150. How did the Aztec feel about the Columbian exchange? ab - bc+ ac, bc - ca+ ab, ca - ab-2bc Que es la cantidad de masa por unidad de volumen? What is 20-12 times 2 Help find Robert! South Carolina people help me find Robert! thank you! What is one way the Pennsylvania colony was able to maintain peace with the Native American people?A.They allowed Native Americans to live with them.B.They became a middle ground for all Native American tribesC.They changed the religious beliefs of Native Americans,They signed treaties to buy Native American land, Steam Workshop Downloader