using
at least three literary device write a short
poem on any topic
of
your own ​

Answers

Answer 1

Simile.

Metaphor.

Imagery.

Symbolism


Related Questions

(2) David had the heart of a servant. Rewrite this sentence using a word to show possession

Answers

Answer: David’s heart is of a servant.

Explanation:

this sentence shows David’s possession of heart

please help no links or get report

In a formal letter, use ____ after the greeting.

Answers

REEEE..... I think it is colon ;-;

Find the distance between point A and point B.
A)
5
B)
6
8
D)
9
T

Answers

Answer:

The answer is A) 5

Explanation:

You could simply count from point A to point B.

Answer:

A) 5

Hope this helps! :3

What is the best order for the sentences in this conclusion paragraph?
1. Perfect attendance is not a goal to work toward, like high grades or good behavior, and sick students should stay home. There are many other ways to honor students at school for factors they can control.

2. Changing this tradition might upset a few people at first, but everyone will see in the long run that it is for the best.

3. So, I think most people will agree that giving out awards for perfect school attendance is a bad idea.
A. 2,1,3

B. 3,1,2

C. 2,3,1

D. 2,3,1

Answers

The best is 3,1,2
Answer: b

Answer: B

Explanation: if you read it in that way it would make most sense (:

Why do we hyperlink information in a personal research? Why is it important?

Answers

Hyperlinking is important in personal research because it allows you to easily access additional information that is relevant to your topic of interest.

By including hyperlinks in your research, you can quickly and easily navigate between different sources of information, which can save you time and make it easier to understand and analyze the information you're studying.

Hyperlinking also allows you to create connections between different pieces of information, which can help you see the big picture of your research and understand how different pieces of information are related. By following the trail of hyperlinks from one source to the next, you can gain a deeper understanding of the topic you're researching and gain new insights.

Additionally, including hyperlinks in your research can help to support the credibility of your work by providing readers with easy access to the sources of the information you've used. It also allows other researchers or readers to validate and consult the sources you have used and explore more information.

Overall, hyperlinking is an important tool that can help you more effectively and efficiently conduct personal research, and it's a key aspect of modern digital research.

Learn more about Hyperlinking:

https://brainly.com/question/30012385

The foundation of the World Wide Web are hyperlinks. Their ability to offer a visitor a multitude of benefits makes them of utmost importance.

Why is material hyperlinked in a personal study project? Why is it crucial?

Links have a variety of uses. They are a crucial component of websites because the links can be used to spread and reinforce a message that a writer may want readers to view (ibid). It's customary in journalism and research to include hyperlinks in articles.

Why are links necessary and what are they?

A hyperlink (or link) is a component on a website, such as a word or button, that directs the user to another place. When you click a link, you will be taken there to the link's intended destination, which could be a webpage, document, or other online material.

To know more about  hyperlink information visit:-

https://brainly.com/question/14548275

#SPJ1

Change to passive voice.
17.-We would receive him with open arms.
18. -The international community is not paying enough attention to this issue.
19.- Many adults are reading Harry Potter's books.
20.-They can sell alcohol in pubs.
21.-New Yorkers are placing and receiving calls.
22.- Great predators rarely eat plants.
23.- The astronauts are giving the journalists a lot of information,
24.-We are going to invite Dr Livingstone to participate in the project.
25.-American companies have introduced a new product in Asia.
26.-The traffic warden gave the driver a ticket.
27.- Radiohead couldn't release their new record last December.
28.-They never gave me instructions.
29.-Medical advances have greatly reduced the number of deaths.​

Answers

17. He would be recieved by us with open arms.

18. The issue isn't being paid enough attention by the international community.

19. Harry Potter's books are being read by many adults.

20. Alcohol can be sold by them in pubs.

21. Calls are being placed and received by New Yorkers.

22. Plants are rarely eaten by great predators.

23. The journalists are being given a lot of information by the astronauts.

24. Dr. Livingstone is going to be invited by us to participate in the project.

25. A new product has been introduced in Asia by American companies.

26. The driver was given a ticket by the traffic warden.

27. Radiohead's new record couldn't be released by them last December.

28. I was never given instructions by them.

29. The number of deaths have greatly reduced by medical advances.

Can someone help me ASAP please I’ll mark Brainly
I have to rewrite the story 3 lil pigs but I must tell it as if I’m the wolf and I’m telling the story it can be how ever u want to put it but must have all parts meaning each house made

Answers

Answer:

The straw house was really easy to blow down because it was not well made. the stick house was a bit harder because sticks are stronger than straw. but the brick house was really hard, and i could not blow it down.

Explanation:

stream is in what stage of the water cycle

Answers

Answer:

Streams are part of the water cycle's collection stage

Explanation:

Read this passage from "The Obligation to Endure": When the public protests, confronted with some obvious evidence of damaging results of pesticide applications, it is fed little tranquilizing pills of half truth. How does this figurative language appeal to Carson's audience in this passage?
a. Carson's use of personification increases the urgency of her writing, highlighting the importance of this issue.
b. Carson's metaphor highlights her creativity, showing her readers that she is a fun person to be around.
c. Carson's use of metaphor appeals to her readers' sense of justice and fairness.
d. Carson's use of personification appeals to her readers' sense of ethics and credibility.

Answers

the correct answer is C. carson’s use of metaphor appeals to her readers’ sense of justic and fairness.

Answer:

Carson's use of metaphor appeals to her readers' sense of justice and fairness.

Explanation:

A P E X

Can someone tell me the right form?
All trademarks are property of their respective owners in the DE and other countries.
or
All trademarks are property of their respective owners in DE and other countries.

Answers

Answer:

All trademarks are property of their respective owners in DE and other countries.

Explanation:

I believe this is the answer, but I may be wrong. I hope this helps, and thanks! BRAINLIEST PLEASE! If I am wrong, I am so sorry, I haven't taken this class. Thanks again!

If I have an F in a class and I get 75 points, will those points bring my grade up? Pls help!!

Answers

Answer:

Depends

Explanation:

If you have an F (anywhere below 65), than one assignment won't help much unless it's a test. A 75 is a C, so it's possible is you have a high f, you could bring your grade up to a D or c-. It will bring your grade up at least slightly. I would recommend asking for extra credit or to redo past tests. I hope this helps you and good luck :)... school is hard :(

Correct degree of comparison in the blank to complete the sentence

Answers

The sentence can be completed with the correct degree of comparison as follows:

Between the two options that you have, the former is better.

What are the degrees of comparison?

The three degrees of comparison are the positive, comparative, and superlative degrees. The positive is the basic form of comparison. For instance, 'small' is a positive form of comparison. No two things are being compared here.

The comparative which is the form used above (better) is for examining two things while the superlative compare more than two things.

Complete Question:

Fill in the blank with the correct degree of comparison:

Between the two options that you have, ......

A. the former is best

B. the former is the best

C. the former is good

D. the former is better

Learn more about the degrees of comparison here:

https://brainly.com/question/284506

#SPJ1

The thesis sentence clearly communicates what the author plans to discuss in the passage. Based on this information, which of the following sentences from the passage is its thesis sentence?

Answers

Answer: Unknown, unable to answer without information.

11:38 PM, 1/8/23 ; Kennwick WA USA 99336 ...

Explanation:

Giving an answer is actually impossible in this case, considering there isn't any sort of section of writing besides "The thesis sentence clearly communicates what the author plans to discuss in the passage. Based on this information, which of the following sentences from the passage is its thesis sentence?"... It doesn't contain any information about what you need help with what so ever. Please fix this, thank you. I am willing to help you, but it's really hard to do so if I don't know what Im helping you with.

You have been asked to write a report for the school magazine on the importance of being active. In your report you must: • give one reason why people are less active nowadays • give two ways that people could become more active • state how important being active is to you. You must write between 100 and 150 words only

50 points

Answers

Are we really that active anymore? Nowadays with all sorts of new technology we aren’t moving around as much as we used to. It is very important to me that we get enough movement in our lives as we progress and get older. Being active is good for your body and helps keep you healthy. Ways that people can become more active include unplugging from electronics and doing things manually. Go outside and get a breath of fresh air or even go on a light jog. Being active is important for our daily lives so we can continue to be healthy and strong throughout the rest of our lives.

how do you see STI ( sexually transmitted infections)​

Answers

Answer:

I don't quite get it but here,

Explanation:

Changes in urination. Burning or pain during urination can be a symptom of several conditions, Abnormal vaginal discharge or bleeding, Burning or itching.

-sorry if im wrong ☹

You can see it through various different symptoms which can be different for each illness - best bet is going on the nhs website

Is this a simple, compound, complex, or
compound-complex sentence?
i tried to get to sleep early because my
exam was scheduled for 8a.m.
O a. Simple
O b. Compound
O c. Complex
O d. Compound-complex

Answers

Answer: d compound complex

Explanation:

Scenario: You took your little brother to Chuck E Cheese during the Winter Break. While you were there, there was a group of teenagers running around, play
fighting, and using foul language. When you complained to a staff member they told you the manager was out sick and there was nothing they could do. Write an
email to the manager of Chuck E Cheese to make a complaint.

Answers

Answer:

Explanation:

To whom it may concern,

Recently, my little brother and I came to this establishment. While we were there, multiple young adults were using foul language and roughhousing. I do not feel this is safe.

Kashmir is what nouns

Answers

Answer:

Kashmir is a proper noun.

Explanation:

Mark me as brainliest...

Answer:

proper noun is the answer

Which of the following is NOT true about fairy tales?
A. Many have different "retellings" across centuries and cultures.
B. Most were told orally before being written down.
C. Most have never been written down.

Answers

Answer:
The answer is A

What are the differences between recreation and leisure? Cite some examples below​

Answers

Examples of recreation activities are walking, swimming, meditation, reading, playing games and dancing. Leisure refers to the free time that people can spend away from their everyday responsibilities:()

What does it mean to be everyones go to?

Answers

Answer:the person they rely on

Explanation:

Answer:

That is a good thing. That means they trust you to always be there for them.

Which excerpt from The War of the Worlds uses a vivid visual description for aesthetic impact?

Answers

Answer: A lank tentacular appendage gripped the edge of the cylinder, another swayed in the air.

Explanation: The word aesthetic refers to a sense of beauty. It typically is conveyed in words by description through the use of adjectives. With the use of the phrase "lank tentacular appendage" the sentences has an aesthetic impact. The sentence does not need these details but helps the reader to have a clear visual picture of the aliens appearance.

Answer:

A

Explanation:

Where should the comma go in the following sentence

Answers

I think it goes after “Money” because there’s a pause depending how you say it. But at the same time it doesn’t need a comma

Please help me with this

Answers

Answer:

right triangle

Explanation:

because it has 90°

Type the word from your spelling list that is a verb meaningto ease one's pain.
spelling list:

Answers

Answer:

relieve

Explanation:

provide relief

Answer:

Relieve

Explanation:

In a sentence:

I was relieved by the fact that I wasn't in trouble.

"Meanwhile, the girl was in a hurry to
arrive at her destination." In the
sentence, identify the transition word.
O Meanwhile
O hurry
O arrive
O destination

Answers

Meanwhile


Is the transition word
Meanwhile is the answer

Why do you think the narrator says of the terrorist, “They wrecked people like me more than anyone?” What does she mean by this?

Answers

The narrator uses this phrase to express how much Arab people were hurt as a result of the 9/11 terrorist attacks. By this, she meant that innocent Arabs began to be unfairly judged and devalued.

How did the 9/11 attacks impact the narrator?The narrator began to be socially devalued.The narrator lost important friends.The narrator lost her husband in the attack.The narrator is judged on her ethnicity.

The narrator of the article is an Arab woman who immigrated to the USA in order to have a more comfortable and satisfying life. However, after the September 11th attacks he had his ethnicity, culture, religion, and life judged and devalued.

Although she has no involvement with these rascals and lost her husband in the attack, she continues to see friends turning away and the squint of American society.

For this reason, she believes that these attacks hurt people like her most, that is, innocent Arab people and Muslims, who in addition to losing their loved ones and friends, have to face social judgment.

This question is about the article "Saffron Dreams."

Learn more about the 9/11 attacks:

https://brainly.com/question/13227981

#SPJ1

Can someone help me with this question?

Answers

Answer: False

Explanation: It can be at the end of the first body paragraph or the beginning of the second body paragraph

alth or w
nion of a
how
be
8. Reproduce the following sentences as indicated in brackets. 10
a. All is well.....? (Supply the correct question tag)
b. Sony is writing a letter. (Change into interrogative)
c. He has been living in this house for one year. (Change into "how
long question)
d. Please don't make so much noise. I ..... (read). (Put the verb in
om
thebracket in the correct tense)
e. Amrita said to me, "Please help me." (Rewrite in reported speech)
f. Rama was collecting data. (Change into passive voice)
g.
She hasn't arrived home yet. (Change into affirmative)
h She wrote a poem, (Change into yes/no question)
i. Nobody invited me to the party. (Change into passive voice)
J.
He said to me, "Don't waste your time." (Change into indirect

Answers

Answer:

a. All is well, isn't it?  

b. Is Sony writing a letter?  

c. How long has he been living in that house?  

d. Please don't make so much noise. I am reading.  

e. Amrita requested me to help her.  

f. Data was collected by Rama.  

g. She has arrived home.  

h. Did she write a poem?  

i. I was not invited to the party by anyone. or I was not invited by anyone to the party.  

j. He told me not to waste my time.

Explanation:

The given sentences and their changed versions are as follows-

a. All is well, isn't it?

Here, the question tag is in the negative as the statement is positive.

b. Is Sony writing a letter?

The interrogative sentence means changing the sentence into question form.

c. How long has he been living in that house?

By using the "how long" form, we remove the answer "for one year" out of the question.

d. Please don't make so much noise. I am reading.

Here, since the event is a present scene, we are using the present continuous form of the verb "read".

e. Amrita requested me to help her.

Reported speech changes the quoted form of the speech and used the past form of the main verb.

f. Data was collected by Rama.

Passive voice is when the subject is acted upon by the verb. Here, the subject is moved to the end of the sentence and the object comes to the front of the sentence.

g. She has arrived home.

An affirmative sentence means a sentence that is positive. So, we changed the "hasn't" to "has".

h. Did she write a poem?

Writing a yes/no question means asking a question to the answer of either "yes/no".

i. I was not invited to the party by anyone. or I was not invited by anyone to the party.

Same as sentence f.

j. He told me not to waste my time.

Same with sentence e.

A oversees students' academic progress in high school and assists with
both career exploration and college plans.

Answers

B guidance counselor

Answer:

B

Explanation:

B guidance counselor

Other Questions
plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history.