help please n thx <3
Answer:
The answer is The cell that contains the nucleus.
NEED ASAP
Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.
Answer:
D
Explanation:
The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.
which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true
PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!
Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows
Explanation:
What are the differences between the Big Bang Theory and the Steady State Theory?
Answer
One is a move and the other is a part of a state.
Explanation:
Answer:
The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.
Choose one carbon sink and explain how the carbon gets out of it.
Answer::
Explanation:
Which element is able to combine in many ways with different elements and is therefore considered the basis of life?
Answer:
Carbon
Explanation:
what is human intercose
practical of human intercose
Answer:
Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)
if a person has a dominant gene and a recessive gene for a certain trait which will be expressed
Answer:
The dominant gene will be expressed
Explanation:
Recessive genes are only expressed when you have two recessive genes and no dominant.
Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune
Where is the error in the diagram?
DNA is copied during the shortest stage.
The cytoplasm divides during the longest stage.
The nucleus divides in the stage before the cytoplasm divides.
Both the nucleus and the cytoplasm divide in the same stage.
Answer:
But where is your diagram
Answer:
C
Explanation:
Explain the law's of segregation and independent assortment.
Answer:
The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.
Explanation:
I know it late but can u plz mark me brainliest?
Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline
3- Scissors are an example of a complex machine.
Answer:
A :3
Explanation:
Just did acceleratted ed. Hope this helps!
Which accurately labels the cytoplasm?
w
Х
Y
Z
Answer:
Y is the answer
Explanation:
what is carrying capacity? what type of population growth does it affect?
Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.
What are the types of carrying capacity?Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.
There are four categories of carrying capacity, namely:
Physical.Ecological.Economic.Social.A specific environment's carrying capacity is the maximum population size that it can support.
The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.
Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.
For more details regarding carrying capacity, visit:
https://brainly.com/question/2375972
#SPJ1
At what temperatures can monarch fly?
Answer:55 degrees
Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.
Answer:
Temperatures need to be above 55 degrees Fahrenheit.
Explanation:
Which of the following events occurs the earliest during the process of photosynthesis?
Answer:
If you give me the choices to choose from I cna answer.
Explanation:
What’s the answer ????????
Answer:
D: Electrons are transferred from one atom to another.
Explanation:
Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.
Hope this helps!
Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT
Answer:
it's B
Explanation:
A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.
What is Yo-yo?Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.
By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.
Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.
To learn more about Total energy of the system, refer to the link:
https://brainly.com/question/478253
#SPJ5
Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants
Answer:
b it is the climate
Explanation:
B the climate
Answer C.Size
Explanation:
the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.
2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?
Answer:
The force is by putting the two same objects on both sides and the motion is the scale
The force is by putting the two same objects on both sides and the motion is the scale.
What do you mean by force?In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.
The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.
Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.
Learn more about force:
https://brainly.com/question/13191643
#SPJ2
What is a carbon producer
Answer:
There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet
What does “denature” mean in terms of protein structure?
Explanation:
Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.
2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method
Answer:
the answer is d scientific method
Answer:d the scientific method
Explanation:
Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell
Answer:
a controls what enters and leaves the cell
Explanation:
What is the use of tail in human sperm?
It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.
Explanation:
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answer:
1 and 5
Explanation:
https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question
Answer:
1.ATTAGC(ATACTAC)GGGC
5. ATGAATGC(ATACTACC)GGGC
This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.
Answer:
The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.
Explanation:
how might toxicology be important to other biomedical professions outside of forensics?
Answer: See explanation
Explanation:
Toxicology is a field in science that has to do with the effects of poisons, toxics and how they can be treated. Through toxicology, one can understand how harms are caused by chemicals and the health of the public can be protected.
Toxicologists study chemicals, drugs and other substances, and looks at how safe they're and their impact on living organisms. Toxicologists help in the development of methods that'll be used to know the harmful effects and the the dosages which causes it.
Furthermore, toxicology gives vital information and knowledge which the decision makers or regulatory agencies
in other biomedical fields can use in order to put programs in place that can be used to limit the exposures of humans to the substances.
In conclusion, less exposure to these substances is vital so that diseases can be prevented.
Toxicology is also used in the field of environmental health.
Toxicology will be important to other biomedical professions outside of forensics. Toxicology can be used in environmental health field which provides critical information and knowledge about the toxic substances that can be used by regulatory agencies to limit our exposures to toxic substances so we can say that toxicology plays an important role for other biomedical professions.
Learn more: https://brainly.com/question/18122705
The process during which a preexisting cell splits to form two cells is called