what is an abiotic factor?

Answers

Answer 1

Answer:

something that isnt from a living thing. Such as a table falling.

Answer 2

Answer:

A non living thing like a rock

Explanation:


Related Questions

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

I will mark brainest if you get it right
Which of these is a practice that sustains or conserves natural resources?
A. Leaving the TV on all day
B. filling the bathtub to the top
C. recycling cans
D. burning newspapers

Answers

Answer:

C recycling cans

Explanation:

What does metabolically inert mean? "Sucrose is soluble but metabolically inert"

Answers

Metabolik olarak inert ne anlama geliyor? "Sakkaroz çözünür ancak metabolik olarak etkisizdir"
Derslerinde başarılar dilerim

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

What is meant by metabolically inert?Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living). They typically consist of an inner core of nucleic acid surrounded by a protein coat (capsid). Simpler viruses may lack a capsid (viroids), whilst more complex viruses may possess an external lipid envelope.

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

To learn more about metabolically inert refer:https://brainly.com/question/1229016

#SPJ2

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

What is the orgenlle that takes place in photosynthesis

Answers

Answer:

chloroplast

Explanation:

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

If a red blood cell is placed in pure distilled water, what do you expect to occur?


Group of answer choices
The cell will remain the same size
The cell will swell and burst
The cell will shrink
None of these

Answers

Answer:

The cell will swell and burst due to the hypotonic solution

Explanation:

what is the name of the process where plants water from their leaves?

Answers

Answer:

Transpiration

Explanation:

Transpiration That’s that

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

1. Blood flowing through the aorta is distributed to all parts of
the body, except the:
A. lungs.
B. small intestine.
C. heart.
D. brain.​

Answers

Answer:

I think d . brain must be the ans


3. The diagram to the right shows a flower.
Which parts of the flower are male reproductive
structures?
A. parts A and B
B. parts C and D
C. parts E and F
D. parts D, E, and F

Answers

Answer:

A. parts A and B

Explanation:

A is the filament and B is the anther

URGENT! HIGH POINTS
Match the following. Each word should be used only one time.
Colossians, deductive, defined, inductive, observations, Romans.


Science deals with __________________ of the physical world.

___________________ reasoning is the process of applying a rule.

___________________ reasoning starts with facts and works toward general conclusions. It is the process of finding a rule.

The statement “2+2=4” can be classified as a _________________ truth.

Christians should try hard to understand science, so that they are not deceived by hollow and deceptive philosophies (__________________ 2:8)

We can improve our relationship with God by studying His creation (____________1:20).

Answers

Answer:

A  Observations  B Deductive  C Inductive  D: Defined  E Colossians  F Romans

Explanation:

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

Place the answer below for the Deck Toys completion (two words)
If you do K12, you might know this

Answers

Answer:

What are the word options?

Explanation:

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Monkeys have a prehensile tail that allows them to grab and hold onto tree branches.

Answers

Answer:

structural adaptation

Explanation:

Adaptation is the way the organism is kept alive in changing life circumstances. Every organism in a dynamic relationship with the environment tends to survive.

Ecological factors determine the living conditions in one habitat. This means that all plants, animals, fungi, and even microorganisms adapt to the conditions

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

Which process is part of transcription?

DNA is copied to create a second DNA strand.
mRNA codons and tRNA anticodons assemble amino acids.
DNA is unzipped with the aid of DNA polymerase.
mRNA is synthesized from a strand of DNA.

Answers

Answer:DNA is copied to create a second DNA strand.

Explanation:Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA molecule. ... RNA polymerase uses one of the DNA strands (the template strand) as a template to make a new, complementary RNA molecule. Transcription ends in a process called termination.

Answer:A

Explanation:

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

Other Questions
Which leader of the Gupta Empire added the most land to the empire? Which method listed below would NOT be used to prove that two triangles are congruent?.A. Prove that two sides and an included angle of one triangle are congruent to two sides and an included angle of the other triangle. B. Prove that two angles and an included side of one triangle are congruent to two angles and an included side of the other triangle. C. Prove all three sets of corresponding sides congruent. D. Prove all three sets of corresponding angles congruent. Jared is driving around a traffic circle. If he is traveling at a speed of 7.1 m/s, and it takes his 5.8 s to complete an entire loop around the traffic circle, what is the radius of the traffic circle?A. 7.1 mB. 6.6 mC. 9.4 mD. 5.6 m Caroline loves bubble gum. Her teacher gives bubble gum to every child who finishes their math facts work sheet in less than one minute. Caroline never finishes in one minute, and she cries when everyone gets bubblegum except for her. The faster she writes her answers, the more mistakes she makes. The most likely reason for the reinforcer not working is ILL GIVE BRAINLIEST!!!No need for explanation, just an answer is fine. Thank you. Select each pair of expressions that are equivalent. 3x + 14 x + 112 and 4x + 134 2 + 6x and 2(3x + 1) 3(x + 1) (1 x) and 2x + 3 3x and 4(x + 1) x 4 5.5 + 2.2x + 3.8x 4.1 and 1.4 + 6x What part of copyright allows you to sell a used book, cd, or dvd as you wish? (7,-4) and (-11,4) finding slope What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer. reorder to make a sentence n'tudiez demain pas vous d'accord A speed skater travels how many meters per second? PLEASE ANSWER ASAP WILL GIVE BRAINLIEST.Which TONE is represented in the following passage?Wow! With a top speed of one hundred fifty miles per hour, that car can almost fly!Question 4 options:annoyedscarycalmexcited who does king juli an fall in love with in All Hail King Ju lian? How do you think weather can affect sailing?What would be good sailing weather? Who owns most factors of production in a market economy?A individualsB. individual statesC. the federal governmentD. community leadersPlease select the best answer from the choices provided OBOD A man stands on a cliff edge. The cliff edge breaks and the man fall. Which law is this an example of? PLEEAAASE IIIIIIIIIII NNNNNNNNNEEEEEEEEEEEEDDDDDDDD HEEEEEEEEEEEEEEEELLLLLLLLLLLPPPPPPPPPPPP You are planning a three day trip to Seattle Washington in October use the fact that on each day it could be either sunny or rainy and that each day is equally likely to be sunny or rainy to answer the following question what is the probability that it rains on at least one day HELP ME ASAP PLEASE!!!! A student attempted to measure the specific latent heat of vaporisation of water.She took the following readings:First balance reading (g) = 581Second balance reading (g) = 526First joulemeter reading (kJ) = 195Second joulemeter reading (kJ) = 327Use these results to determine the specific latent heat of vaporisation of water. Steam Workshop Downloader