Based on Memorandum DM-CI-2020-00085 entitled Guidelines for Work
Immersion Implementation during Crisis Situation, enumerate the schemes wherein
the Work Immersion activities in all tracks can be performed. What scheme is most
appropriate in Pasig City? Why?
Work immersion activities are designed to provide students with hands on experience in a workplace environment, allowing them to apply the knowledge and skills they have learned in the classroom. There are several schemes that can be used to implement work immersion activities, including the following:
In-house immersion - this involves the student doing the immersion in the same institution where he or she is studying. This can be in the form of laboratory work or on-the-job training within the institution.
Industry immersion - this involves the student doing the immersion in an industry partner of the institution. This can be in the form of apprenticeship, practicum or internship programs.
Community immersion - this involves the student doing the immersion in the community. This can be in the form of service learning or community-based activities.
To learn more about Memorandum here
https://brainly.com/question/28393741
#SPJ4
today, all of the courts in our country have have been unified and have both legal and equity jurisprudence. true false
The legal cure will take priority if neither party has been wronged and both are in an equitable position. The value will not give a precise cure on the off case that the two players have equivalent causes. The correct answer is true.
A Chancery Equity Court is authorized by law to apply the equity principle rather than the law to cases brought before it. The rules and principles that emerge from exercising residuary powers are the living foundation of the state's legal system.
Value is an overall set of laws for getting a fair outcome while existing regulations don't give an answer. A settled and formal body of substantive and procedural rules and doctrines that supplement, assist, or override common and statutory law is the English Chancery system of law.
To learn more about equivalent causes here
https://brainly.com/question/15016716
#SPJ4
At a crime scene you find a piece of glass with a red, dried liquid, and a yellow fiber on the edge lying on the ground. Upon closer inspection, you notice
that there is also a smudged fingerprint crossing the center of the glass. Explain how you would collect, preserve and analyze all of this evidence. What
would you hope to find out from each piece of evidence? Indicate whether the glass, red liquid, fingerprint and yellow fiber are Individual or Class
evidence and discuss why.
The process of collecting, preserving, and analyzing evidence at a crime scene is called forensic investigation. The process involves identifying, preserving, analyzing, and documenting evidence.
The collection of evidence should be detailed enough to include as many relevant clues as possible but at the same time, sufficiently selective not to hinder the laboratory analysis.
Evidence always keeps up the quality when preserved in its initial condition as it was obtained from the crime scene. Whenever evidence is submitted in the court as an exhibit, the officials should establish the continuity of possessions of the evidence, which in legal terms is known as the chain of custody.
In your case, you would collect the glass with red liquid and yellow fiber on the edge lying on the ground and a smudged fingerprint crossing the center of the glass. You would preserve each piece of evidence separately to avoid contamination. You would analyze each piece of evidence separately to find out what happened at the crime scene. The glass could be analyzed for fingerprints or DNA. The red liquid could be analyzed for blood or other substances. The yellow fiber could be analyzed for its composition or origin.
The glass and red liquid are individual evidence because they can be traced back to a single source. The fingerprint and yellow fiber are class evidence because they cannot be traced back to a single source.
Learn more about the chain of custody:
https://brainly.com/question/28699126.
#SPJ11
Fatima Omar has just graduated from the university and she is looking for a job. Fatima’s family has good relations with a local Law Office which they used to consult it from time to time on matters that concern the family. Last week Fatima wrote to the Law Office stating the following: "I am really upset about what my uncle recently did. He had, since I was young, promised me that he would give me his Mercedes when he got a new car. He got a new car and instead of giving his old car to me, he gave it to his son who he just made up with after years of hating each other. I feel that the car should be mine. Can I do anything to get the car?" What advise the Law office should give to Fatima?
The Law Office should advise Fatima that unfortunately, she may not have a legal claim to the car. While her uncle may have promised her the car, promises are not necessarily legally binding unless they are in the form of a contract or other legally enforceable agreement.
Additionally, even if there was some sort of agreement between Fatima and her uncle, he still has the right to change his mind and give the car to someone else. The Law Office should explain that inheritance and gift laws generally do not favor one person over another based on promises or verbal agreements.
However, if Fatima believes that her uncle's actions were motivated by discrimination or some other unlawful factor, then she may have legal grounds for a claim. In general, the Law Office should advise Fatima to discuss the situation with her uncle and try to come to a peaceful resolution.
To know more about verbal agreements visit:
https://brainly.com/question/26175614
#SPJ11
Which of the following statements is true about the Patients' Bill of Rights?
The Patients' Bill of Rights is the fifteenth amendment to the U.S. Constitution.
No one universal government statute exists.
The Patients' Bill of Rights is part of HITECH.
The American Hospital Association has a Patients' Bill of Rights that became federal law.
Answer:
The American Hospital Association has a Patients' Bill of Rights that became federal law.
Explanation:
To protect your private information and medical information
What branch of government do regulatory agencies fall under?.
Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.
The celebrated Mount Lemmon Fire District v. Guido was a momentous United States Supreme Court case which was determined on October 11th, 2018 regarding the comprehension of the venerable Age Discrimination in Employment Act (ADEA).
Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.Two firefighters, John Guido and Dennis Rankin, who were both more than 40-years old, formalized an action against this particular governmental division of the state of Arizona asserting that they had been dismissed due to their age unlawfully in negation of the established ADEA.
However, the District ardently contended that it ought not be subject to the ADEA's edicts since it employed fewer than 20 personnel.
Read more on Mount Lemmon Fire District v. Guido here https://brainly.com/question/26174453
#SPJ1
Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.)
decision and reasoning
The legal decisions in Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.) are given as follows.
Why is this so?The Tennessee Supreme Court's verdict in Michael Devereux v. United Parcel Service, Inc., determined that a lower court had made an error in providing UPS with summary judgement against an age and disability discrimination lawsuit filed by one of their employees.
The court declared that the employee presented ample evidence to establish a tangible dispute over substantive matters regarding whether UPS carried out discriminatory practices against him.
The decision was grounded on provisions stated under the Tennessee Human Rights Act, which bars employment-based discriminations associated with age and disability.
Learn more about legal decisions at:
https://brainly.com/question/10660758
#SPJ1
in which types of court martial will a private have a right to military counsel
In the United States military justice system, a private accused of an offense in a court-martial has the right to be represented by military counsel, also known as a military defense lawyer or military defense counsel, in all types of court-martial.
The three types of court-martial are:
Summary Court-Martial: This is the lowest level of court-martial and is typically used for minor offenses. In a summary court-martial, the accused has the right to be represented by military counsel if one is available.
Special Court-Martial: This is a mid-level court-martial and is typically used for more serious offenses. In a special court-martial, the accused has the right to be represented by military counsel.
General Court-Martial: This is the highest level of court-martial and is typically used for the most serious offenses. In a general court-martial, the accused has the right to be represented by military counsel.
In all types of court-martial, the accused has the right to be represented by a military defense counsel, regardless of their rank or position within the military. The military defense counsel is provided by the military and is a trained lawyer who is familiar with military law and court-martial procedures.
It is a general rule that a foetus is not a legal subject (does not have rights, duties, and capacities). the south african law applies the nasciturus fiction as a legal exception to this rule. discuss the application of the nasciturus fiction as a legal exception in the light of exparte bodel steenkamp 1962 (3) sa 954 (o). write a legal article to discuss this statement and also refer to other applicable case law and other sources of law in the subject.
A legal theory in South African law known as the nasciturus fiction, that recognizes the fetus as a legal subject for particular purposes. It is based on the notion that a fetus in utero is assumed to have been born for all purposes provided that it is subsequently born alive and advantageous to it.
As opposed to being a rule of law, the nasciturus fiction is a legal presumption that can be disproved by evidence. Exparte Bodel Steenkamp, a case where the unborn child had a right to inherit from its mother's estate, is one instance where this is acknowledged in South African case law.
The nasciturus fiction is also acknowledged in South African legal statutes, such as the Intestate Succession Act, which states that a child born alive after the death of an intestate person who was conceived before their death is entitled to inherit from their estate. An example of how the nasciturus fiction has been used in South African law is the case of Exparte Bodel Steenkamp 1962 (3) SA 954 (O).
Learn more about Succession Act at:
brainly.com/question/12408045
#SPJ4
If private security agents are subject to prosecution in the U. S. Courts, why would the U. S. Want to hire any of these
private security forces?
Private security agents are subject to prosecution in U.S. courts because they are required to comply with the same laws and regulations as everyone else. However, there may be situations where the U.S. government chooses to hire private security forces for certain tasks or missions.
There are several reasons why the U.S. government might choose to hire private security forces. One reason is that private security forces may have specialized skills or expertise that the government lacks or cannot easily access. For example, private security forces may have experience in providing security in hostile environments or conducting sensitive intelligence operations.
Another reason is that private security forces may be more cost-effective than using government resources. Private security forces are typically hired on a contractual basis, which allows the government to avoid the long-term costs associated with maintaining a standing military or law enforcement force.
To know more about Court System here
https://brainly.com/question/29615892
#SPJ4
What was the Court's position on redrawing congressional districts to promote minority interests?
The Court has generally recognized the need to protect minority voting rights in redrawing congressional districts. This recognition stems from the Voting Rights Act of 1965, which aims to prevent racial discrimination in voting practices.
However, the Court has also set limits on the extent to which redistricting can be done to promote minority interests.
In a series of cases, such as Shaw v. Reno (1993) and Miller v. Johnson (1995), the Court has held that redistricting based predominantly on racial considerations is unconstitutional under the Equal Protection Clause of the 14th Amendment unless it can be justified as a narrowly tailored remedy for past racial discrimination.
In other words, while promoting minority interests in congressional districts is an important goal, the Court has made it clear that this goal cannot be pursued at the expense of other constitutional principles, such as equal protection under the law.
To sum up, the Court's position on redrawing congressional districts to promote minority interests is that it is permissible, but only to the extent that it does not infringe upon other constitutional rights and is a narrowly tailored remedy to address past racial discrimination.
To learn more about congressional districts, visit: https://brainly.com/question/27644952
#SPJ11
what statute of limitations falsifying business records?
The statute of limitations for falsifying business records varies depending on the jurisdiction and the severity of the offense.
In general, it can range from one to seven years. It is important to note that falsifying business records is a serious crime and can result in significant penalties, including fines and imprisonment. It is always best to consult with a legal professional for specific guidance on the statute of limitations and other legal matters related to falsifying business records.For example, in New York State, falsifying business records is a Class A misdemeanor, and the statute of limitations is two years from the commission of the offense (New York Penal Law § 30.10(2)(c)).
In California, falsifying business records is a wobbler offense that can be charged as either a felony or misdemeanor, and the statute of limitations for both is three years from the date of the offense (California Penal Code § 802).It's important to note that the statute of limitations may be extended in certain circumstances, such as if the defendant is absent from the jurisdiction or if new evidence comes to light. It's best to consult with a lawyer familiar with the relevant laws in your jurisdiction for specific guidance on this matter.
Learn more about limitations falsifying here:https://brainly.com/question/28435088
#SPJ11
Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.)
Facts:
Michael Devereux, who is the employee, was a “shifter” for United Parcel Service, Inc., who is the employer. His job involved moving semi-trailers to and from the loading dock of Employer’s package-sorting facility in Whites Creek, Tennessee. He began working for Employer on a part-time basis in 1977, while still in high school. He was terminated in 2006. Mr. Devereux sustained a compensable injury to his left knee in March 2005.
Decision and reasoning
Devereux's termination was not wrongful as he failed to provide adequate medical evidence showing he could perform job duties with reasonable accommodations.
The Tennessee Supreme Court concluded in Michael Devereux v. United Parcel Service, Inc. that when the employer fired Devereux from his job, neither the Americans with Disabilities Act nor the Tennessee Workers' Compensation Act was broken. Despite having a compensable left knee injury in March 2005, Devereux failed to offer sufficient medical proof that he could carry out his job obligations with acceptable modifications.
As a consequence, it was determined that the employer's choice to terminate his employment was legal. Devereux's lengthy work with the company, which began on a part-time basis in 1977, was insufficient to trump the decision to let him go in this instance.
Learn more about accommodations:
https://brainly.com/question/30793782
#SPJ1
On Halloween night, John and several of his friends decided to pull some pranks at their high school and damaged some of the classrooms. The next morning, school security officers reviewed the security videotapes to see who had done the damage. What will the students be charged with?
Answer:
The students may be charged with vandalism or malicious mischief, which involves damaging or defacing property without the owner's consent. Depending on the severity of the damage, the charges could be a misdemeanor or a felony. In addition to criminal charges, the students could also face disciplinary action from their school, including suspension or expulsion. It is important to note that vandalism is a serious crime and can have long-lasting consequences for the individuals involved.
Explanation:
Thomas Pogge proposes a "global resource dividend" as one aspect of
a. A global scheme for wealthy nations to use cheap labor from developing countries.
b. A global scheme for affluent nations and citizens of affluent nations to compensare the poon
c. A global scheme for affluent nations to buy commodities from the poor
d. A global pyramid scheme for affluent nations to further exploit the poon
Thomas Pogge proposes a "global resource dividend" as one aspect of a global scheme for affluent nations and citizens of affluent nations to compensate the poor. Hence, Option b) is the correct answer.
According to Pogge, the resources of the world are not distributed fairly, and as a result, the poorest nations suffer the most. The global resource dividend is a way to address this issue by redistributing the profits of natural resources, such as oil and gas, to the people of poor countries.
Pogge argues that this is a moral obligation of wealthy nations, as they benefit from the exploitation of resources in poor countries. By sharing the profits with the people of those countries, the global resource dividend can help to reduce poverty and inequality. The scheme is not a way to exploit the poor further or to buy commodities from them, but rather a way to provide compensation for the exploitation that has already occurred.
The global resource dividend is a way to promote justice and fairness in the global economy and to ensure that the benefits of natural resources are shared more equitably.
To learn more about natural resources, visit: https://brainly.com/question/13354731
#SPJ11
Under the save our homes amendment in florida annual homestead assessment increases are limited to what maximum percentage
Under the Save Our Homes Amendment in Florida, annual homestead assessment increases are limited to a maximum percentage of 3%. This means that the assessed value of homestead property cannot increase by more than 3% per year, even if the actual market value of the property increases by a higher percentage.
The Save Our Homes Amendment in Florida is a constitutional amendment that was approved by voters in 1992. This amendment provides property tax relief for homeowners in the state by capping the amount that property assessments can increase annually. Specifically, the amendment limits annual increases in the assessed value of homestead property to the lower of 3% or the increase in the Consumer Price Index (CPI). Additionally, the amendment allows homeowners to transfer some or all of their accumulated homestead exemption savings to a new property if they move within the state. Overall, the Save Our Homes Amendment has helped to provide stability and predictability in property tax assessments for Florida homeowners.
Learn more about annual homestead assessment: https://brainly.com/question/30896341.
#SPJ11
What is the STR found within the DNA sequence? TCATGCGATGATGATGATGATCGCT
A. CAT
B. GCG
C. ACG
D. GAT
The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.
In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.
It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.
Learn more about Short Tandem Repeat at:
brainly.com/question/29661522
#SPJ4
Write a three- to five-page report explaining the process.
explain the agency and type of information you want to see and why. write down reasons that the information might not be available.
conduct a search to see if the information is already available. document your search.
if the information is not yet available, submit a foia request to that agency. document this process.
analyze the process—what worked, what didn’t work, why you think that is, etc.
if you receive the information (because it is already available or the government sends it to you) explain if the records you are seeing meet your expectations and why or why not.
if you have received the information and it is available online, provide a link. if not, provide a brief description of it. if the information was not yet available and you had to request it, include a copy of your request in the final report.
Introduction The Freedom of Information Act (FOIA) is a federal law that allows individuals to request access to government agency records. The FOIA provides transparency to the government’s activities and helps citizens to understand the government's decision-making processes. In this report, we will explain the process of submitting a FOIA request and provide an analysis of the process.
Agency and Type of Information
For this report, we are interested in obtaining information from the Environmental Protection Agency (EPA) related to the regulation of a particular chemical used in food packaging. Specifically, we want to see any records related to the EPA’s evaluation of the safety of the chemical and any correspondence between the EPA and the company that produces the chemical.
Reasons the Information Might Not Be Available
There are several reasons why the information we are interested in might not be available. The records could be classified or contain sensitive information that cannot be released to the public. Additionally, the records could have been destroyed or lost, or they could be in the process of being reviewed for release.
Conduct a Search
We first conducted a search of the EPA’s website to see if the information we were interested in was already available. We searched for keywords related to the chemical and the regulation of food packaging. However, we did not find any records that matched our search criteria.
Submit a FOIA Request
As the information we were interested in was not available, we submitted a FOIA request to the EPA. We submitted our request using the online FOIA portal provided by the agency. We provided a detailed description of the records we were seeking and why we were interested in them.
Analysis of the Process
The process of submitting a FOIA request was relatively straightforward. The online FOIA portal provided by the EPA was easy to use, and the instructions were clear. However, the process of receiving a response from the agency can be lengthy. The EPA has 20 business days to respond to a FOIA request, but this timeline can be extended in certain circumstances.
To learn more about Reporters here
https://brainly.com/question/27937774
#SPJ4
Explain the substantive and procedural protections afforded by the Fourth, Fifth, and Sixth Amendments for defendants charged with crimes today
The Fourth, Fifth, and Sixth Amendments provide substantive and procedural protections for defendants charged with crimes today.
Explanation:The Fourth, Fifth, and Sixth Amendments of the United States Constitution provide substantive and procedural protections for defendants charged with crimes today.
The Fourth Amendment protects against unreasonable searches and seizures. This means that law enforcement must have a warrant based on probable cause in order to search a person, their property, or their belongings.
The Fifth Amendment protects against self-incrimination and double jeopardy. It guarantees the right to remain silent and protects individuals from being tried for the same crime twice.
The Sixth Amendment guarantees several rights for defendants, including the right to a fair trial, the right to confront witnesses, the right to have a lawyer present, and the right to a speedy and public trial.
Learn more about Protections under the Fourth, Fifth, and Sixth Amendments here:https://brainly.com/question/31534315
#SPJ2
4. using some of the insights from environmental criminology, do you think your neighborhood is likely to have high or low rates of crime? why? give specific examples in your answer.
Environmental criminology suggests that crime is not solely the result of individual characteristics, but is also influenced by environmental factors. These factors can include physical features of the environment, such as the layout of streets and buildings, as well as social and economic conditions, such as poverty and inequality.
Based on these factors, a neighborhood with high levels of crime might have characteristics such as:
Poorly maintained or abandoned buildings and public spaces, which may attract criminal activity.
High levels of poverty and unemployment, which can lead to desperation and criminal behavior.
A lack of social cohesion or community involvement, which can make it easier for criminals to operate without fear of detection.
A history of crime and violence, which can lead to a "culture of crime" in the area.
On the other hand, a neighborhood with low levels of crime might have characteristics such as:
Well-maintained public spaces and buildings, which can discourage criminal activity.
A strong sense of community and social cohesion, which can make it more difficult for criminals to operate unnoticed.
Good social and economic conditions, such as low levels of poverty and unemployment, which can reduce the likelihood of criminal behavior.
Good infrastructure and access to services, such as education and healthcare, which can improve overall quality of life and reduce desperation that can lead to crime
To learn more about criminology here
https://brainly.com/question/28996894
#SPJ4
members of congress fill all of the following roles except that of:
a. cabinet members
b. legislature
c. committee member
d. servant of the constitution
Members of congress fill all of the following roles except that of Cabinet members. The correct option is a.
The Cabinet is made up of appointed leaders of executive departments who offer the President policy advice. On the other hand members of Congress are elected officials who work in the legislative branch of government and are in charge of passing laws and standing up for their constituents.
As part of their duties in the government, members of Congress participate in committee work and have a responsibility to uphold the Constitution. Congressmen are the Constitution's servants. They swear under penalty of perjury to uphold and protect the US Constitution from all enemies both domestic and foreign. The correct option is a.
Learn more about Cabinet members at:
brainly.com/question/11131513
#SPJ4
Suppose that, under a new city ordinance, police officers would have a choice when it comes to dealing with persons possessing less than four ounces of marijuana. relying on their discretion, officers could (a) arrest the offender, leading to possible jail time; or (b) write the offender a ticket, treating the infraction like a traffic violation. would this be a just and fair policy? would it make it easier or more difficult for police officers to protect the community? why or why not?
Under the proposed city ordinance, police officers would have discretion when dealing with individuals possessing less than four ounces of marijuana. They could either (a) arrest the offender, leading to possible jail time or (b) write the offender a ticket, treating the infraction like a traffic violation.
Whether this policy is just and fair depends on various factors, such as the potential for unequal treatment, the prioritization of law enforcement resources, and the impacts on the community. On one hand, allowing officer discretion could lead to inconsistencies and potential biases in how offenders are treated. On the other hand, treating minor marijuana possession as a traffic violation could reduce the burden on the criminal justice system and allow officers to focus on more serious crimes.
As for the impact on police officers protecting the community, this policy could make it easier for them to allocate resources more effectively and concentrate on higher-priority issues. However, if discretion is not applied consistently and fairly, it could create mistrust and tensions within the community. Ultimately, the success of this policy would depend on how effectively it is implemented and monitored.
To know more about the Illegality of Marijuana Possession- https://brainly.com/question/29800924
#SPJ11
how to get guardianship of a child without going to court
The company is about to launch a new online product. Realizing that it will soon have to support customers in all time zones, management is considering outsourcing its help desk to provide round-the-clock customer care
The company is about to launch a new online product. Realizing that it will soon have to support customers in all time zones, management is considering outsourcing its help desk to provide round-the-clock customer care can be a cost cutting solution.
There are potential risks and difficulties with outsourcing. The business should carefully weigh the costs and benefits of each option and consider the standing, capabilities and experience of the outsourcing vendor before making a choice. Clear performance metrics, service level agreements as well as efficient communication and monitoring systems should be established if outsourcing is chosen.
To ensure that the company's brand values and standards for customer service are upheld, adequate training and resources should be made available. If the business chooses to outsource, it should set up service level agreements and clear performance metrics with the vendor. In order to make certain that the vendor complies with the agreed upon standards, it should also put in place efficient communication and monitoring systems.
Learn more about outsourcing vendor at:
brainly.com/question/28197224
#SPJ4
During a time of social upheaval, criminologists believe that some people who would normally be law-abiding citizens commit crimes. Given the feelings of desperation that these large events often bring on, what crime would a normally law-abiding person MOST likely commit?
A.
murder
B.
arson
C.
child abuse
D.
looting
During times of social upheaval, criminologists have found that normally law-abiding citizens may be more likely to commit crimes such as looting. Therefore, option D is the correct answer.
This is because the desperation and chaos of large events can lead people to feel like they have no other option but to break the law in order to survive. While murder, arson, and child abuse are all serious crimes, they are less likely to be committed by someone who is typically law-abiding.
Looting, on the other hand, is a crime that may be more tempting for someone who is struggling to get by during a time of social unrest. This is because looting can provide a quick way to obtain resources and goods that may be otherwise unavailable.
However, it is important to note that not everyone who experiences social upheaval will resort to crime and that there are always alternatives to breaking the law.
To learn more about social upheaval, visit: https://brainly.com/question/28663388
#SPJ11
A person is driving and hears a Police siren behind them. They do not know what they have done wrong. What should they do?
If a person is driving and hears a police siren behind them, they should pull over to the right side of the road and stop the vehicle as soon as it is safe to do so. They should remain calm and wait for the police officer to approach them. It is important to follow the officer's instructions and be respectful. If the person is unsure why they were pulled over, they can ask the officer for clarification. It is important to remember that the police officer is there to ensure everyone's safety, and cooperation can help resolve the situation quickly and smoothly.
4 factors that determine what committee a member of congress joins
Answer:
Explanation:
There are several factors that can influence which committee a member of Congress joins, including:
The member's personal interests and expertise: Members of Congress may join committees that align with their personal interests or areas of expertise, allowing them to have a greater impact on issues that they care about.
The member's constituency: Members of Congress may also join committees that are particularly relevant to the needs and interests of their constituents. For example, a member representing a district with a significant agricultural sector may join the Agriculture Committee.
The member's seniority: Seniority is often an important factor in committee assignments, particularly in the House of Representatives. Members who have been in Congress longer may have greater opportunities to join high-profile committees.
The needs of the party leadership: The party leadership may also play a role in committee assignments, particularly for members who are seen as potential leaders within the party. Party leaders may try to place members on committees that align with the party's priorities and where they can have the greatest impact on policy.
PLS MARK ME BRAINLIEST
The four factors that determine what committee a member of Congress joins are party affiliation, seniority, personal interests, and constituent needs.
Party affiliation is often the most important factor, as committee assignments are usually controlled by the majority party in each chamber. Seniority is also a significant factor, as more experienced members often receive priority in committee assignments. Personal interests can also play a role, as members may seek out committees that align with their expertise or policy goals.
Finally, constituent needs may influence committee assignments, as members may prioritize committees that address issues important to their constituents. Overall, committee assignments are a key way that members of Congress can shape policy and influence the legislative process.
Learn more about Congress: https://brainly.com/question/779570
#SPJ11
T/F The United States Court System is very simplistic and easy to follow due to federalism?
The statement The United States Court System is very simplistic and easy to follow due to federalism is false as The United States Court System is complex and not necessarily easy to follow due to federalism
The court system is made up of federal and state courts, with multiple levels of courts in each system. Each level of court has different responsibilities and jurisdictions, making the system intricate and challenging to navigate. Additionally, federalism creates the possibility for different interpretations of the law by different state courts, which can create further complexity.
The United States Court System is a complex system consisting of both federal and state courts. The federal court system is made up of the Supreme Court, 13 circuit courts of appeals, and 94 district courts. The state court system varies from state to state, but generally includes trial courts, appellate courts, and a state supreme court. The court system is responsible for interpreting and applying the law, resolving disputes, and ensuring justice is served. The court system plays a crucial role in the American legal system, and its decisions have far-reaching consequences.
To know more about United States Court System here
https://brainly.com/question/29615892
#SPJ4
Sarah grows rosebushes that she decided to sell online. She ships them using an airline. Does the airline carrier owe Sarah a duty to deliver her goods (the rosebushes) properly?
No, proper delivery is not the duty of the airline carrier.
No, proper delivery is not the duty of the airline carrier.
Yes, proper delivery is the duty of the airline carrier.
Yes, proper delivery is the duty of the airline carrier.
No, proper delivery is the duty of the seller.
No, proper delivery is the duty of the seller.
No, proper delivery is the duty of the consumer
Yes, proper delivery is the duty of the airline carrier is the correct answer which is option C
When Sarah decides to ship her rosebushes using an airline carrier, the airline carrier assumes the responsibility of delivering the goods to the intended destination in a safe and timely manner. This is known as the duty of care, which is a legal obligation that requires the airline carrier to exercise reasonable care in handling and transporting the goods. If the airline carrier fails to deliver the goods properly, Sarah may have a legal claim for damages against the carrier.
Option C is correct
To know more about delivery, here
https://brainly.com/question/21840716
#SPJ4