Which is the electron configuration for nobelium (No)?
[Rn]7s25f14
[Rn]7s25f7
[Ne]3s23p7
[Xe]6s25d1

Answers

Answer 1

Answer:

[Rn]7s25f14

Explanation:

Answer 2

[tex][Rn]5f^{14}7s^2[/tex] is the electron configuration for nobelium (No).

Explanation:

The electronic configuration of an element is the distribution of its electrons in different energy levels around the atomic nucleus.It is written with help of an atomic number of an element.

Given:

The element nobelium.

To find:

The electronic configuration of nobelium

Solution:

The atomic number of nobelium is 102.

The number of protons = Atomic number = 102

The number of electrons = Number of protons = 102

There are 102 electrons in atom nobelium and they will be filled according to the Aufbau rule that the electron will be filled in a subshell with lower orbital energy.

The electronic configuration of nobelium :

[tex][No]=1s^22s^22p^63s^23p^63d^{10}4s^24p^64d^{10}5s^25p^64f^{14}5d^{10}6s^26p^65f^{14}7s^2[/tex]

Or we can also write the above electronic configuration as:

[tex][No]=[Rn]5f^{14}7s^2[/tex]

[tex][Rn]5f^{14}7s^2[/tex] is the electron configuration for nobelium (No).

Learn more about electronic configuration here:

brainly.com/question/11628377

brainly.com/question/5524513?referrer=searchResults


Related Questions

What is the mass in grams, if you have 8.42 x 10^18 atoms of Bromine

Answers

Answer:

84.2 grams

Explanation:

you have to multiply 8.42x10^18 to get the answer above

The number of the atom can be used to estimate the mass and moles of the substance by Avogadro's number. The mass of 8.42 x 10¹⁸ atoms of Bromine is equivalent to 0.0011 grams.

What is the mole concept?

The mole concept has been the unit of the amount of estimating the mass of the substances with smaller entities. It uses the SI unit mol to measure the amount of mass. It also has been defined by 6.02214076 × 10²³ (Nₐ, Avogadro's number) elementary entities.

The molar mass of  Bromine (Br) is 79.904 u and atoms are 8.42 x 10¹⁸.

Atoms to mass are converted as:

= ( 8.42 x 10¹⁸ atom ÷ 1 ) × ( 1 mole Br ÷ 6.02214076×10²³ ) × (79.904 gm Br ÷ 1 mol Br)

= (8.42 x 10¹⁸ × 79.904 gm) ÷ 6.02214076 × 10²³

= 6.727 × 10²⁰ ÷ 6.02214076 × 10²³

= 1.117 × 10⁻³ grams

Therefore, 0.0011 grams is the mass of bromine.

Learn more about the mole concept, here:

https://brainly.com/question/22540912

#SPJ2

The change of matter, solid, liquid and gas is called a_________.

Answers

Answer:

This would be a phase change

Explanation:

Since the diffrent phases solid,liquid,gas are changing to other phases.

Sorry for the bad explanation.

If carbon lost one proton, what atom would be formed

Answers

Answer:

boron

Explanation:

boron has 5 protons and carbon has 6, so if carbon lost a proton, it would become boron since each element has a unique number of protons.

As each element has a different number of protons, boron has five and carbon has six, so if carbon lost one of its protons, it would change into boron.

What is proton ?

Every atom has a proton, a subatomic particle, in its nucleus. The particle possesses an electrical charge that is positive and opposite to the electron's.

In the reaction, a proton is forfeited. Keep in mind that when the number of protons changes, the atomic number also changes, creating a new element. Carbon-14 is the end result as a result. It is a new element, yet it has the same mass as nitrogen-14.

When carbon creates covalent bonds, pairs of electrons are shared between the atoms instead of being gained or lost as happens with chemical bonds. The ability of carbon to construct lengthy chains of atoms and so create intricate biological compounds is due in part to this feature.

Thus, If carbon lost one proton, boron atom would be formed.

To learn more about proton, follow the link;

https://brainly.com/question/1252435

#SPJ2

Can someone help me find the 5 digits numbers in here?

Answers

Answer:

20322

Explanation:

Could it have something to deal with the teeth or mouths? The first pumpkin you have two teeth, second pumpkin looks like a 0, the third pumpkin I’m unsure of. The forth pumpkin has two teeth again same with the fifth.

So first pumpkin - 2
The second pumpkin - 0
The third pumpkin I’m unsure of
The forth pumpkin - 2
The fifth pumpkin - 2
So 20?22

Just an idea for ya. Hopefully it helps

I NEED HELP QUICK Activity:
Part 1: Write all bold vocabulary and define the words (See attached PDF File below). Make sure to number each.

Part 2: Look at the "Second Read of Investigating Landforms On Venus" worksheet (Slide 14) and highlight text to the questions on the worksheet.

Part 3: Answer the questions on the "Second Read of Investigating Landforms On Venus" worksheet: 1) How were the novae on Venus similar to the landforms in Geyra's computer model? AND 2) How did the results of Gerya's model provide evidence for what formed the novae on Venus? (Slide 16)

Part 4: Write the notes: (Slide 19)
3) Scientists can use models to test their ideas and get evidence about processes in the natural world that are difficult to observe.

Exit Slip: How do models help scientists answer questions?

Answers

Lucy and her bike together have a mass of 120 kg. She slows down from 4.5 m/s to 3.5 m/s. How much kinetic energy does she lose?

How many grams of sugar must be dissolved in 150 mL of water to make a solution with a concentration of 0.6 g/mL?

Answers

Answer:

250

Explanation:

all you have to do is divide them its simple division cause its by the volume by the density

Mass can be calculated by using moles which can be further calculated from multiplication of Molarity to volume. The mass of sugar to make this solution is  8.6 kg.

What is molarity?

Molarity can be calculated by dividing  number of moles of solute by volume of solution in litre. Molarity is affected by temperature. Its unit is mole/litre. It measure the concentration of any solute in a solution.

Other concentration terms are molality, normality and mole fraction. Molarity can be used to find out the ionic strength of any solution

Mathematically,

Molarity= number of moles of solute/volume of solution in litre

Where,

moles= given weight /by molecular weight

         = w/ 96.0858

Substituting values in equation 1

0.6=(w/96.0858)/(150 )

w=8.6 kg

Thus the mass of sugar is 8.6 kg.

Learn more about Molarity, here:

https://brainly.com/question/16727614

#SPJ2

How many significant figures are in 20600?

Answers

There are 3 significant figures in 20600.

Who wants to do my acellus work? Or know how to get the answers ?

Answers

im just answering questions to get points Explanation:

i dont know what points do

Answer:

Hello I passed my Chemistry exam (Acellus) in the beginning of June:)

Explanation:

Two substances each have a
temperature of 23 degrees Celsius.
After they are combined the
temperature rises to 27 degrees
Celsius. What evidence proves a
chemical reaction occurred?

Answers

The answer is temperature change

What is the Mechanical advantage of a machine that only changes the direction of the force?

Answers

Answer: 1

Explanation:

The number of times a machine increases a force exerted on it The input force will be the same as the output force.

How do you know which elements increases or which elements decreases on a Ionisation graph? Like how can you figure out that these elements will increase on the graph and which will decrease?​

Answers

Explanation:

There is a trend in the periodic table.

I.E increases up the group and across the period. So you know that metals have less I.E compared to non-metals.

The atomic weight of iodine is less than the atomic weight of tellurium. However, Mendeleev listed iodine after tellurium in his original periodic table because he suspected the atomic weights for these elements were inaccurate. What was Mendeleev's reason for this suspicion?

Answers

Explanation :

As we know that Mendeleev arranged the elements in horizontal rows and vertical columns of a table in order of their increasing relative atomic weights.

He placed the elements with similar nature in the same group.

According to the question, the atomic weight of iodine is less than the atomic weight of tellurium. So according to this, iodine should be placed before tellurium in Mendeleev's tables. But Mendeleev placed iodine after tellurium in his original periodic table.

However, iodine has similar chemical properties to chlorine and bromine. So, in order to make iodine queue up with chlorine and bromine in his periodic table, Mendeleev exchanged the positions of iodine and tellurium.

As we know that the positions of iodine and tellurium were reversed in Mendeleev's table because iodine has one naturally occurring isotope that is iodine-127  and tellurium isotopes are tellurium-128 and tellurium-130.

Due to high relative abundance of tellurium isotopes gives tellurium the greater relative atomic mass.

Prompt
Explain how plate tectonics have changed Earth's surface over time. Include the role of plate tectonics in the creation of landforms.

Answers

According to plate tectonics theory, Earth's outer shell is divided into multiple plates that slowly glide over the mantle. This slowly changes Earth's surface over time by merging, or separating, continents.

Answer:      The theory of plate tectonics tells us that the earth's surface sits on plates that shift due to the built up pressure underneath. When the pressure gets too much, it has to escape somewhere so it goes to the edges of the plate and causes earthquakes. This in turn causes the surface to shift.

If the molar mass of a hydrocarbon is 26.0 g/mol and it’s empirical formula is CH what is the molecular formula

Answers

The
empirical formula
is the simplest whole number ration that defines constituent atoms in a species. The
molecular formula
is always a multiple of the
empirical formula
.

What has the higher first ionization energy? Mg or Cl

Answers

Ionization Trend: First ionization energy will increase left to right across a period and increase bottom to top of a family (column).

If we compare Mg and Cl:

Mg is column 2 (far left) in the periodic table, while Cl is column 17 (far right). Based on the ionization rule explained above, Cl will have the higher first ionization energy.

how does tungsten most common isotope relate to the average atomic mass of the element

Answers

Answer:

It has the most quantitative effect on the average atomic mass of the element.

Explanation:

Tungsten's most common isotope will have the most quantitative effect on the average atomic mass.

The most common isotope of tungsten will represent its most abundant isotope.

The proportion by which each element occurs in nature is the geonormal abundance. The geonormal abundance is used to calculate the average atomic mass.

The isotope with the most geonormal abundance will have the highest effect on the average atomic mass of an element.

which solution has no effect on litmus?
1) acidic
2) basic
3) alkaline
4) neutral

Answers

1 is the answer

Hope this help

I don't understand how and why some transition metals form more than one ions eg: copper forms two. PLS EXPLAIN. I WILL GIVE YOU BRAINLIEST.PLS EXPLAIN PROPERLY AND IN FULL DETAIL. I AM IN YEAR 9.
THANKYOU
USE COPPER OXIDE IONS AS AN EXAMPLE.
7-8 POINTS

Answers

Answer:because some have more radiation than others causing mutations and there for either decreasing or increasing the amount of ions

copper is a acidic metal in general therefor it will most likely erode faster than any other metal making it hard to determan the number of ions in general the metal will have basicly what I’m trying to say is there is no solid answer as many metals can change there ions for no given reason

Explanation:

How did Mendeleev decide which elements should be placed in the same group of the periodic table?

Answers

Answer:

He grouped elements with similar chemical and physical properties.

Hope this helps

Explain what is meant by the natural abundance of isotopes. Can someone help me to answer this plz

Answers

“Is a percentage of atoms with a specific atomic mass found in a naturally occurring sample of an element.” < you can try and put it in your own words or you could stick with that just add quotations :)

how did rutherford contribute to atomic theory?

Answers

Explanation:

Rutherford’s laboratory showed that when alpha particles are fired into gas atoms, a few are violently deflected, which implies a dense, positively charged central region containing most of the atomic mass.

What is a possible reason that ecosystem 2 has fewer species than ecosystem 1?

Answers

it doesn't repopulate as fast because ecosystem 2 could have more trouble reproducing then ecosystem 1.

Where are each part of the atoms located?

Answers

Answer: With the portion of hydrogen, all atoms have three parts. The parts of an atom are protons, electrons, and neutrons. A proton is accurately charged and is located in the center or nucleus of the atom. Electrons are negatively charged and are located in rings or orbits spinning around the nucleus.

Explanation: I hope this was helpful.

Answer dis please I will like and 5 star if correct

Answers

C I think not 100% sure

Characteristics help scientists ______objects.
(A) isolate
(B) identify
(C) theorize
(D) quantify

Answers

Answer:

b

Explanation:

identify objects.

B because i wouldn’t know but honestly it sounds the like the best answer because I don’t think characteristics help scientists theorize objects

i need help to pass my class

Answers

Answer:

B

Explanation:

The attraction is stronger when the magnet is closer so moving it away would decrease the strength.

Which is a characteristic of calcium?

A.It has two neutrons

B.It has two energy shells

C.It has two protons

D.It has two electrons in its outer energy shell

Answers

The answer is D
It has two electrons in its outer energy shell

Which is NOT a source of bias? Pick one.

A. Accurate Records

B. Equipment Choice

C. Funding Source

D. Hypothesis Information

Answers

Answer:

A: Accurate Records

Explanation:

I think the answer is A. Accurate Records

Explain why energy sources do not have 100% efficiency. Why do you think some have lower efficiencies?

Answers

Answer:

Energy sources do not have 100% efficiency because the processes of energy conversion to usable forms involves energy losses.

Some have lower efficiencies due to; energy losses in form of heat during conversion, poor technology applied during conversion of energy and lack of desire equipment to use in the energy conversion system.

Explanation:

The desired form of energy for use is derived from conversion of energy from the source using an energy converter into another form which is usable. The efficiency of the energy converter is calculated as;

л = output energy/input energy

The efficiency of energy is limited to the cost of equipment required for conversion from energy source by the energy converter to a form which is usable. Additionally, because energy sources are scarce, the technology to use in energy  conversion is a factor affecting energy efficiency in that high efficiency will require advanced technology with better equipment leading higher costs of that energy form. when heat losses are involved during energy conversion, efficiency lowers, thus its better if such losses are used as energy input in another system.

pls help me i have to turn this in in less than 15 min.

Answers

Answer:

Last one

Explanation:

Answer:

Boiling point!

Explanation:

Distilled water is capable of being heated beyond the normal boiling point due to absence of dissolved impurities which provide nucleating points at the normal boiling point.

If you enjoyed my answer, I'd appreicate a Thanks and a rating!

Have a great day!

Other Questions
(1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there.