Which of the following contain(s) oxygenated blood?
*its Arterioles edgBz21 pls pst

Which Of The Following Contain(s) Oxygenated Blood?*its Arterioles EdgBz21 Pls Pst

Answers

Answer 1

Answer:

c. Arterioles is correct

Explanation:


Related Questions

5. What does Grover give Percy?

Answers

Answer:

Explanation:

Grover gives Percy a present in a shoebox and  it's the horn that Percy snapped off of the head of the Minotaur.

Answered by the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

HOPE THIS HELPED!!

True or false
processing maintains quality control .​

Answers

Answer:

True

(I am not 100% sure because the question is very short with no context, but I believe it to be true)

Which type of bleed would typically be more urgent to treat—venous or arterial?

Answers

Answer:

Arterial bleeding is more dangerous than venous bleeding. The arteries carry blood from the body and back into the heart. If the arteries become damaged and start to bleed out, an individual can suffer loss of life within five minutes if the bleeding is severe and if no medical attention is received.

how do radiation, conduction, and convection affect the atmosphere?​

Answers

Answer:

Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.

Explanation:

#KEEP LEARNING

Help Me pls?!?!??? Plsssss

Answers

Answer:

its b

Explanation:

I remember I did this

Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be

Answers

Answer: Gg

Explanation:

Please help with this I’m being timed

Answers

Answer:

cell inhibitors

Explanation:

edge


BRAINIEST ANSWER!

HELP :))

Answers

Answer:

True

Explanation:

Don't know tell me if I'm wrong

Answer:

True

Explanation:

Actually it destroyed a LOT more than that...

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

Volume of the large cube is 7.506 x 10 mm. The volume of each small cube is 2.78 X 104 mm'. How many small cubes make up the large cube?

Answers

Answer:

27

Explanation:

WILL GIVE BRAINLIEST TO BEST ANSWER NO LINKS Select the correct answer.
In 2002, Colorado was suffering from extreme drought. Which technology will help Colorado reduce the effects of future droughts?
A.
building sea walls
B.
building levees
C.
building dams
D.
building storm shelters

Answers

Answer:

Building dams is the technology that will help Colorado reduce the effects of future droughts.

Explanation:

i dont know why people are putting links up insted of awnsers. Have a nice day :)

Answer:

C. Building dams

Explanation:

dams can store and reserve water for future use (resevoirs)

If your cells couldn't go through meiosis- how could this affect you?

Answers

Answer:

An organism would not be able to reproduce without meiosis.

Explanation:

Between meiosis and mitosis, meiosis is by far not as important. If you are a asexual organism, this would be NOT IMPORTANT whatsoever. If you are a sexual organism, this would LARGLY effect you. But on a world scale, this is NOT AS IMPORTANT.

This is because, without mitosis, you could not heal and would die much much younger since your cells could not be replaced. On the other hand, without meiosis, any organism that reproduces sexually would be unable to do so, which could lead to extinction in many, many species. This would not be harmful, however, to species that can also or mainly reporuduce asexually through budding, fragmenting, or sporing. So overall:

Organisms that produce sexually would go extinct.

This is the only real affect I can think of. Since meiosis does not  produce any cells aside from reproductive cells. And asexual organisms produce reproductive cells through other means.

Ti⊂k∫∈s ω∅∅p

What helps meteorologists to forecast the weather?

Answers

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

Answer:

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:

where does mold come from?​

Answers

Mold is found everyone and can grow on almost any substance when moisture is presented. Mold could grow on non cellulose materials (plastic,metal, etc)

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

PLEASE HELP WILL MARK BRAINLIST The group of animals (a pod of orcas) shown below is an example of What level of organization? Community Population Ecosystems Individual​

Answers

Answer:

The answer is likely population or community

Explanation:

the reason that it is not an ecosystem is because an ecosystem is more than just than group of animals itself it also includes the water and things growing underneath it. The reason that it is not an individual is because there is more than one there (a group).


PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2

Answers

Answer:

109kg? would hit the ground with more force

Explanation:

Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess

Use the images below to answer the question. 2. What makes all of the samples different from each other?​

Answers

Answer:

Shape and structure.

Explanation:

The difference in shape and structure of these pictures is responsible for the difference from each other. The organisms present in these pictures are different in their size, shape and composition of their body. Some are small and some are large, some are living while the others are non-living, some are very hard whereas the others are soft and fleshy. So the organisms present in these samples are different from each other in a variety of ways i.e. size, shape and body structure.

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

Help plzzzz!!!!!!!???!!!!!

Answers

The answer is A.
As the population increases, so will deforestation. With deforestation, habitats will be destroyed leading to a decrease.

Why are archaea in a different domain from bacteria?
A. They are multicellular, but bacteria are unicellular.
B. They are thought to have separate paths of evolutionary
development
C. They are able to perform endosymbiosis, but bacteria are not.
D. They have no similar characteristics.

Answers

Answer:B

Explanation:

Archaea is in a different domain from bacteria because they are thought to have separate paths of evolutionary development. Therefore, the correct statement is option B.

What are the differences between archaea and bacteria domains?

Archaea and bacteria are both prokaryotic organisms, but archaea are more closely related to eukaryotes than bacteria. Archaea have unique  lipid membrane and cell wall components that are different in composition than those found in bacteria.

These differences suggest that archaea and bacteria evolved to have separate paths of evolutionary development early in the history of life on Earth and then classified into Archaea and Bacteria domains.

Based on the phylogenetic tree constructed by researchers, the tree has classified life into three domains which are Archaea, Bacteria, and Eukarya These domains are based on their fundamental genetic and biochemical differences.

Therefore, archaea and bacteria are in a different domain because they followed separate paths of evolutionary development.

Learn more about the archaea domain here:

https://brainly.com/question/31089143

#SPJ5

I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2

Answers

Answer: 1. ??? 2. I cannot read it

Answer:

What does it say?

Explanation:

If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?

Answers

Answer:

Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.

Explanation:

hope this helps:)

Other Questions
PLEASE HELP ASAP I'M BEING TIMED!!!!!!!!!!!! WILL MARK BRAINLIEST IF 100% CORRECT!!!!!!!!!!!!!!!!!For a brief period from May 1822 to March 1823, Agustn de Iturbide, named himself the First Emperor of Mexico, but was later executed when he returned from exile in 1824.True/False Review #3 (TYPE ANSWERS HERE)10 of 1510 of 15 ItemsQuestionPOSSIBLE POINTS: 210) A student has a cup containing 5 green, 5 red, 5 yellow and 5 orange skittles. The student randomly takes a skittle out of the cup (and replaces it) 20 times. The results are:Red: 3 timesYellow: 7 timesOrange: 4 timesGreen: 6 timesWhat is the relative frequency (experimental probability) of getting an orange skittle?.What is the theoretical Probability of getting an orange skittle? y = 8 3^x for x = 4 20 POINTS Escribe una oracion con la palabra prisionero Nervioso intranquilo y bajo In circle o,find the value of x, rounded to the nearest tenth. Scuba diver dives at a rate of 20 ft./min. If the diver starts at the surface what is the depth of the diver after 4 minute A coach is buying snacks for 22 players on a soccer match chip is a total of $77 to buy each player a bottle of water and energy bar the price of one energy bar is two dollars what is Ethyl butyrate used for 7.Which of the following is nota a way to brainstorm for a persuasive writing topic?using sentence startersscanning a newspaperloopingmaking a quick list Please answer this quick!! The _____ of a _____ can be found by dividing the area of the whole circle by ______. How do you find radius from cercumference?(if at all Possible) Snakes have traces of leglike structures that are not usedfor movement what inference supports the fact? What fatal flaw did General McClellan have that made him a bad general? Who was violent opponent of slavery Solve the system of equations x + 2y = 8 and - 2x - 3y = - 7 by combining the equations. There is a total of 45 playoff games over c days. Write the expression of the number of playoff games happening each day. A heavy piece of equipment has wheels on one side and legs on the other as shown in the diagram below.Two people are trying to move the equipment. Each person grabs a handle and begins to lift. The first person imparts an upward force of 300 N and the second person imparts an upward force of 290 N. This is enough to lift the side of the equipment, but they also need to get it moving.While maintaining the upward forces, the first person imparts a horizontal force of 185 N and the second person a horizontal force of 205 N. They maintain these forces while the equipment begins to move.What is the total force in the horizontal direction?____NWhat is the total force in the upward direction?____NDetermine the magnitude and direction of this resultant vector (the resultant vector from combining the forces of the two people).Magnitude:____NDirection:_____ When planning a performance, which question could help you identify the form of your selected piece? Does the piece speed up or slow down? Does the melody repeat often? Does the music gradually get louder or softer? Does the scale sound happy or sad? write an equation for the nth term of the arithmetic sequence. Then find a40.6,-1,-8,-15,....