Which of these elements has an atom with the most stable outer electron configuration?

1.Br 2.Ne 3.Zn 4.Ag

Answers

Answer 1

Answer:

Ne

Explanation:

Neon is the element with the most stable outer electron configuration because it has eight valence electrons that fill the outer shell. Eight electrons in the outer shell is the most stable arrangement of electrons. Neon is also a noble gas which means that due to it already having a complete outer shell, it doesn't lose, gain, or share electrons. Therefore, it is stable.

Hope that helps.


Related Questions

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Which one is correct? Please hurry, the audio is just reading the question!

Answers

I think it is D! Hope this helps

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

When the equations Na + O2 → Na2O is balanced the coefficient for O2 is
a) 1
b) 2
c) 3
d) 4

Answers

A) 1

4Na +O2 products to 2Na2O

The coefficient of oxygen gas (O2) in the following balanced equation is: 4Na + O2 → 2Na2O, is 1.

BALANCING EQUATION:

A balanced equation is an equation that contains the same number of atoms of each element on both sides of the equation.

Balancing a chemical reaction requires the use of coefficients, which are numbers placed in front of the elements/compounds involved.

According to this question, the following reaction is given:

Na + O2 → Na2O

The balanced chemical equation using coefficients is as follows:

4Na + O2 → 2Na2O

This balanced equation shows that 1 mole of oxygen is involved, hence, the coefficient is 1.

Learn more about coefficient of balanced equation at: https://brainly.com/question/21049751?referrer=searchResults

For the chemical reaction of ammonia combustion, write the expressions for velocity chemical reactions as a change in the concentration of all participants: 4 NH 3 (S ) + 5O 2 ( g )  4 NO ( g ) + 6 H 2 O ( g )

Answers

Answer:

See explanation

Explanation:

We define the rate of reaction as the rate of disappearance of reactants or the rate of appearance of products. The negative sign written before the rate of change of concentration of reactants shows that their concentration decreases with time.

The rate of reaction in terms of the concentration of each reactant or product is shown below;

Rate = -1/4d[NH3]/dt

Rate = -1/5d[O2]/dt

Rate = 1/4d[NO]/dt

Rate = 1/6[H2O]/dt

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

2. Explain how to determine the wavelength of a wave.
Type your answer here.
I

Answers

Answer:

Hope it helps:)

Explanation:

Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...

To find the wavelength of a wave;

The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.

Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride

Answers

Explanation:

Fluorine: F-

Aluminium: Al3+

Bromine: Br-

3F2 + 2AlBr3 => 3Br2 + 2AlF3

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

What is balanced equation?

An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.

The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

Therefore, the balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

To know more about balanced equation, here:

https://brainly.com/question/29769009

#SPJ2

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

What actions can you take to reduce your impact on society?

Answers

Answer:

Cut Down On Waste. One of the simplest ways you can reduce your impact on the planet is by cutting down on waste. ...

Support Sustainable Companies. ...

Limit Your Meat Intake. ...

Reduce Energy and Water Use. ...

Offset Your Carbon Emissions. ...

Re-purpose, Recycle, and Borrow.

Explanation:

Plz mark brainliest thanks

Helpz me pleaz! I don't quite get it

Answers

Answer:

Al2O3

Explanation:

Al2O3 has an ionic bond because the bonds between them are very strong

KBr and Al2O3 it’s due to relative size of oxygen and aluminum and polarizing power of Al

HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!

Answers

Answer:

dalton

Explanation:

believe his first name is james, if your not to sure search it

I think the only answer it Rurherford

In trying to control fall armyworms in crops, an Agriculture extension officer applied cypermethrin which was prepared by dissolving 200g of the cypermethrin , C22H19Cl2NO3 in 1000g of water H2O . Calculate the mole fraction of cypermethrin in the solution.

Answers

Answer:

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.0086

Explanation:

Mole fraction remains a sort of concentration. It indicates:

moles of solute / (moles of solute + moles of solvent)

Moles of solute / Total moles.

Solute: Cypermethrin → C₂₂H₁₉Cl₂NO₃

Solvent: Water (PM = 18g/mol)

We calculate moles from solvent: 1000g /18 g/mol = 55.5 moles

We calculate PM for C₂₂H₁₉Cl₂NO₃

12g/mol . 22 + 1g/mol . 19 + 35.45 g/mol . 2+ 14g/mol + 16g/mol . 3 = 416 g/m

Moles of solute: 200 g / 416g/mol = 0.481 moles

Total moles: 0.481 + 55.5 = 55.98 moles

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.481 moles / 55.98 moles = 0.0086

How are mass and density different

Answers

Answer:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

Answer:

brainleist

pls

Explanation:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?

Answers

The percent yield : 73.5%

Further explanation

Given

Reaction

C+2H₂⇒CH₄

Required

The percent yield

Solution

mol of Carbon(as a limiting reactant) :

[tex]\tt \dfrac{100}{12}=8.3[/tex]

mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3

Mass of Methane(theoretical yield) :

[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]

[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]

Other Questions
Which of the following is not true about energy?A. It can cause something to move.B. It gets stronger the more you use itC. It is the ability to cause change.D. It is the ability to do work ---------------------- use of the Internet to access programs and data on computers that are not owned and managed by the user often using large data centers Evaluate 29 + 3r for q = 4 and r = 5.O 23O 511O 17 what is the square rute of 24. WILL GIVE YOU BRILLIENTGwen uses a copying machine to increase the size of her drawings. The copying machine is set to triple the length of her drawings.Let d represent the length of Gwen's original drawing.Which expression represents the length of a copy of Gwen's drawing? A. d 3 B. d 3 C. d + 3 D. d 3 Rewrite 45 + 60 using the distributive property. Ethos is the Greek word forO profitO logicO characterO authority Why was the Louisiana purchase important? Select the correct answer.Which skill allows a veterinary technician to calculate and formulate dosages?.motor skillOB. intellectual skillOC.observational skillOD.communication skillO E. self-motivation A plane parallel to the base of a pyramid divides the pyramid into two pieces. Find the ratio of the volume of the top part of the whole pyramid to the volume of the bottom part. need the answer thank you 2.Which provides evidence for evolution?A. modern organisms closely resembling fossilsB. different animals developing with the same patternsC. multiple species growing in very different waysD. different animals having very different body structures What did colonists in the Boston tea party do after they boycotted tea?(50 pts and brainlist) 5. Choose the best answer.Find the slope and y-intercept of the equation; then choose the equation in slope-Intercept form.3.3x 3y = 2.4slopey -interceptslope-intercept form how would u describe color to a color blind person? How did the doctrine of Manifest Destiny impact legislative compromises What are 3 factors that led to the creation of youth gangs in Central America? In a G.P the difference between the 1st and 5th term is 150, and the difference between the 2nd and the 4th terms is 48. Find the sum of the first five terms. '' Sustainable development preserves natural means and resources for future generation'' Clarify with examples. 7+9+ 3z 2z + 4(Show work please) Steam Workshop Downloader