Who was the most influential British criminologist in all of criminology?
A. Charles Goring
B. Roger Matthews
C. Stuart Hall
D. Mary MacIntosh

Answers

Answer 1

Roger Matthews was the most influential British criminologist in all of criminology

Who was the most influential British criminologist in all of criminology?

Criminology has been a substantial and wide-ranging academic field that compresses abundant hypothetical outlooks and examination regions. To decide on the mainly influential British criminologist is not simple as numerous erudites have produced momentous additions to this domain.

Jock Young, for example, was an early investigator in the area of cultural criminology and also one of the first scholars to investigate the effect of global integration on criminality.

Read more on criminology here:https://brainly.com/question/14317864

#SPJ1


Related Questions

If private security agents are subject to prosecution in the U. S. Courts, why would the U. S. Want to hire any of these


private security forces?

Answers

Private security agents are subject to prosecution in U.S. courts because they are required to comply with the same laws and regulations as everyone else. However, there may be situations where the U.S. government chooses to hire private security forces for certain tasks or missions.

There are several reasons why the U.S. government might choose to hire private security forces. One reason is that private security forces may have specialized skills or expertise that the government lacks or cannot easily access. For example, private security forces may have experience in providing security in hostile environments or conducting sensitive intelligence operations.

Another reason is that private security forces may be more cost-effective than using government resources. Private security forces are typically hired on a contractual basis, which allows the government to avoid the long-term costs associated with maintaining a standing military or law enforcement force.

To know more about  Court System here

https://brainly.com/question/29615892

#SPJ4

Fatima Omar has just graduated from the university and she is looking for a job. Fatima’s family has good relations with a local Law Office which they used to consult it from time to time on matters that concern the family. Last week Fatima wrote to the Law Office stating the following: "I am really upset about what my uncle recently did. He had, since I was young, promised me that he would give me his Mercedes when he got a new car. He got a new car and instead of giving his old car to me, he gave it to his son who he just made up with after years of hating each other. I feel that the car should be mine. Can I do anything to get the car?" What advise the Law office should give to Fatima?

Answers

The Law Office should advise Fatima that unfortunately, she may not have a legal claim to the car. While her uncle may have promised her the car, promises are not necessarily legally binding unless they are in the form of a contract or other legally enforceable agreement.

Additionally, even if there was some sort of agreement between Fatima and her uncle, he still has the right to change his mind and give the car to someone else. The Law Office should explain that inheritance and gift laws generally do not favor one person over another based on promises or verbal agreements.

However, if Fatima believes that her uncle's actions were motivated by discrimination or some other unlawful factor, then she may have legal grounds for a claim. In general, the Law Office should advise Fatima to discuss the situation with her uncle and try to come to a peaceful resolution.

To know more about verbal agreements visit:

https://brainly.com/question/26175614

#SPJ11

The company is about to launch a new online product. Realizing that it will soon have to support customers in all time zones, management is considering outsourcing its help desk to provide round-the-clock customer care

Answers

The company is about to launch a new online product. Realizing that it will soon have to support customers in all time zones, management is considering outsourcing its help desk to provide round-the-clock customer care can be a cost cutting solution.

There are potential risks and difficulties with outsourcing. The business should carefully weigh the costs and benefits of each option and consider the standing, capabilities and experience of the outsourcing vendor before making a choice. Clear performance metrics, service level agreements as well as efficient communication and monitoring systems should be established if outsourcing is chosen.

To ensure that the company's brand values and standards for customer service are upheld, adequate training and resources should be made available. If the business chooses to outsource, it should set up service level agreements and clear performance metrics with the vendor. In order to make certain that the vendor complies with the agreed upon standards, it should also put in place efficient communication and monitoring systems.

Learn more about outsourcing vendor at:

brainly.com/question/28197224

#SPJ4

Contrast the pre-union development of south africa’s constitutional law history with the post-apartheid period with reference to the application of the ‘rule of law’

Answers

South Africa's constitutional law history pre-union was characterized by the colonial powers' imposition of their legal systems on the indigenous people. The colonial powers treated African customary law as inferior and refused to recognize it.

The apartheid regime's constitutional law was designed to maintain white supremacy and exclude non-white South Africans from political and social participation. The post-apartheid period, on the other hand, is marked by the promotion of the rule of law, democracy, and constitutionalism.

The 1996 Constitution guarantees equal protection and benefit of the law to all South Africans and recognizes customary law as equal to common law. The judiciary is independent and has the power of judicial review. The rule of law has been used to ensure that government decisions are lawful, rational, and procedurally fair.

However, challenges remain, such as the slow pace of land reform and the widespread corruption in government. Nonetheless, South Africa's post-apartheid constitutional law history demonstrates a commitment to the rule of law and the principles of democracy and constitutionalism.

To know more about colonial powers visit:

https://brainly.com/question/14465232

#SPJ11

Tricia found a body that is in rigor mortis. How was she MOST likely to determine that this was happening?

Answers

Answer:

Explanation:

Rigor mortis is the stiffening of the body's muscles that occurs after death, due to a chemical change in the muscle tissue. The onset and progression of rigour mortis can provide valuable information about the time of death and can be used to help determine the cause of death.

Tricia is most likely to determine that the body is in rigour mortis by observing the stiffness and rigidity of the body's muscles. During rigour mortis, the body becomes stiff and immobile, and the muscles are difficult to move or manipulate. This stiffness typically begins within a few hours after death and reaches its peak after approximately 12-24 hours, before gradually diminishing over the next 24-48 hours.

Tricia could also confirm rigour mortis by attempting to move the body's joints or limbs. During rigour mortis, the joints become fixed and difficult to move, and the limbs may be difficult to flex or extend. Additionally, Tricia may observe other signs of death, such as livor mortis (a purplish-red discolouration of the skin due to blood settling) and algor mortis (the cooling of the body temperature after death).

PLS MARK ME BRAINLIEST

Tricia most likely determined that the body was in rigor mortis by observing the stiffening of the muscles and joints. Rigor mortis is a postmortem process where the body becomes stiff due to the depletion of ATP, which is necessary for muscle relaxation. This stiffness usually starts within 2-4 hours after death and reaches maximum stiffness in about 12 hours. Therefore, if Tricia observed a stiff and immobile body, it would be a strong indication that the body was in rigor mortis.


To determine rigor mortis, Tricia would have:

1. Checked for stiffness: She would have noticed that the body's muscles were stiff and difficult to move, indicating that rigor mortis had set in.
2. Assessed the body's temperature: Rigor mortis typically starts a few hours after death, and the body would be cold to touch at this stage.
3. Looked for other post-mortem signs: To be certain of rigor mortis, Tricia might also have checked for other post-mortem changes such as livor mortis (discolouration of the skin) or algor mortis (body temperature decrease).

By observing these signs, Tricia was most likely able to determine that the body was in rigor mortis.

Learn more about rigor mortis: https://brainly.com/question/13554527.

#SPJ11

Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.)
decision and reasoning

Answers

The legal decisions in Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.) are given as follows.

Why is this so?

The Tennessee Supreme Court's verdict in Michael Devereux v. United Parcel Service, Inc., determined that a lower court had made an error in providing UPS with summary judgement against an age and disability discrimination lawsuit filed by one of their employees.

The court declared that the employee presented ample evidence to establish a tangible dispute over substantive matters regarding whether UPS carried out discriminatory practices against him.

The decision was grounded on provisions stated under the Tennessee Human Rights Act, which bars employment-based discriminations associated with age and disability.

Learn more about legal decisions at:

https://brainly.com/question/10660758

#SPJ1

During a time of social upheaval, criminologists believe that some people who would normally be law-abiding citizens commit crimes. Given the feelings of desperation that these large events often bring on, what crime would a normally law-abiding person MOST likely commit?



A.


murder



B.


arson



C.


child abuse



D.


looting

Answers

During times of social upheaval, criminologists have found that normally law-abiding citizens may be more likely to commit crimes such as looting. Therefore, option D is the correct answer.

This is because the desperation and chaos of large events can lead people to feel like they have no other option but to break the law in order to survive. While murder, arson, and child abuse are all serious crimes, they are less likely to be committed by someone who is typically law-abiding.

Looting, on the other hand, is a crime that may be more tempting for someone who is struggling to get by during a time of social unrest. This is because looting can provide a quick way to obtain resources and goods that may be otherwise unavailable.

However, it is important to note that not everyone who experiences social upheaval will resort to crime and that there are always alternatives to breaking the law.

To learn more about social upheaval, visit: https://brainly.com/question/28663388

#SPJ11

A system like 'Cap & Trade' in which businesses can buy and sell licenses which permit the emission of a certain amount of greenhouse gases is an example of?

Answers

Answer:

The system described is an example of an emissions trading scheme (ETS). In an ETS, a cap is set on the total amount of greenhouse gas emissions allowed, and then permits or credits representing the right to emit a certain amount of greenhouse gases are created and distributed among businesses. Businesses that emit less than their allotted amount can sell their unused permits to other businesses that need more permits to cover their emissions. This creates a market for emissions permits and provides an economic incentive for businesses to reduce their greenhouse gas emissions.

What can be derived from a firearm and its projectiles?

Answers

Firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.

What informs firearms and their projectiles?

Firearms and their projectiles can provide a wealth of information to investigators and forensic experts in criminal investigations, as well as to engineers and researchers studying the performance and characteristics of firearms.

From a firearm, one can determine its make, model, and caliber. The firearm's serial number can also be used to trace its ownership and history. The condition of the firearm can provide information about its maintenance and use.

From the projectile, one can determine the caliber, type of bullet, and the angle of impact. The projectile's trajectory can be used to determine the location of the shooter and the direction of the shot.

Forensic experts can also analyze the gunshot residue left on the firearm and the shooter's hands to determine if the person fired the weapon. The presence of fingerprints or DNA on the firearm can also be used to identify the shooter.

Overall, firearms and their projectiles can provide important clues and evidence in criminal investigations and can help experts better understand the performance and characteristics of firearms.

learn more about Firearms and their projectiles: https://brainly.com/question/30244650

#SPJ1

4 factors that determine what committee a member of congress joins

Answers

Answer:

Explanation:

There are several factors that can influence which committee a member of Congress joins, including:

The member's personal interests and expertise: Members of Congress may join committees that align with their personal interests or areas of expertise, allowing them to have a greater impact on issues that they care about.

The member's constituency: Members of Congress may also join committees that are particularly relevant to the needs and interests of their constituents. For example, a member representing a district with a significant agricultural sector may join the Agriculture Committee.

The member's seniority: Seniority is often an important factor in committee assignments, particularly in the House of Representatives. Members who have been in Congress longer may have greater opportunities to join high-profile committees.

The needs of the party leadership: The party leadership may also play a role in committee assignments, particularly for members who are seen as potential leaders within the party. Party leaders may try to place members on committees that align with the party's priorities and where they can have the greatest impact on policy.

PLS MARK ME BRAINLIEST

The four factors that determine what committee a member of Congress joins are party affiliation, seniority, personal interests, and constituent needs.

Party affiliation is often the most important factor, as committee assignments are usually controlled by the majority party in each chamber. Seniority is also a significant factor, as more experienced members often receive priority in committee assignments. Personal interests can also play a role, as members may seek out committees that align with their expertise or policy goals.

Finally, constituent needs may influence committee assignments, as members may prioritize committees that address issues important to their constituents. Overall, committee assignments are a key way that members of Congress can shape policy and influence the legislative process.

Learn more about Congress: https://brainly.com/question/779570

#SPJ11

4. using some of the insights from environmental criminology, do you think your neighborhood is likely to have high or low rates of crime? why? give specific examples in your answer.

Answers

Environmental criminology suggests that crime is not solely the result of individual characteristics, but is also influenced by environmental factors. These factors can include physical features of the environment, such as the layout of streets and buildings, as well as social and economic conditions, such as poverty and inequality.

Based on these factors, a neighborhood with high levels of crime might have characteristics such as:

Poorly maintained or abandoned buildings and public spaces, which may attract criminal activity.

High levels of poverty and unemployment, which can lead to desperation and criminal behavior.

A lack of social cohesion or community involvement, which can make it easier for criminals to operate without fear of detection.

A history of crime and violence, which can lead to a "culture of crime" in the area.

On the other hand, a neighborhood with low levels of crime might have characteristics such as:

Well-maintained public spaces and buildings, which can discourage criminal activity.

A strong sense of community and social cohesion, which can make it more difficult for criminals to operate unnoticed.

Good social and economic conditions, such as low levels of poverty and unemployment, which can reduce the likelihood of criminal behavior.

Good infrastructure and access to services, such as education and healthcare, which can improve overall quality of life and reduce desperation that can lead to crime

To learn more about criminology here

https://brainly.com/question/28996894

#SPJ4

Should a Loss Prevention Officer be able to put his hands on and hand-cuff a child (5-13) to protect store property?

Answers

It is not appropriate for a Loss Prevention Officer to physically restrain or handcuff a child (5-13) to protect store property, as it should only be used in situations where there is an imminent threat to safety.

Who is a Loss Prevention Officer?

A Loss Prevention Officer is an employee of a business who is responsible for preventing theft and other losses within the store.

A Loss Prevention Officer should not physically restrain or handcuff a child (aged 5-13) to protect store property. The use of physical force or restraints should only be used in situations where there is a clear and imminent threat to the safety of the public or the officer, and where it is necessary to prevent harm.

The use of force on a child should be a last resort and must be proportionate to the situation. Additionally, many jurisdictions have laws and regulations in place that prohibit the use of physical force or restraints on minors, except in extreme cases of danger.

Learn more about Loss Prevention Officer on:

https://brainly.com/question/30214543

#SPJ1

ASAP!!!!! Write a 200-word description of the five personal characteristics (ethical, physical, and mental) that emergency professionals should possess. Provide specific examples of how the characteristics are necessary. You may also explain incidents where these personal attributes would be especially important

Answers

Emergency professionals, such as first responders, paramedics, and firefighters, must possess various personal characteristics to perform their jobs effectively. These characteristics include ethical, physical, and mental attributes.



Firstly, emergency professionals must possess ethical characteristics, such as honesty, integrity, and trustworthiness. They must uphold a high moral standard and maintain confidentiality to ensure they earn the trust of those they serve.

Secondly, emergency professionals must possess physical characteristics, such as strength, endurance, and agility, to perform physically demanding tasks. For example, firefighters must be able to carry heavy equipment and climb ladders quickly to rescue people from burning buildings.

Thirdly, emergency professionals must possess mental characteristics, such as quick thinking, problem-solving skills, and emotional resilience, to make critical decisions under pressure. For example, paramedics must be able to assess patients' conditions quickly and accurately to provide life-saving treatment.

Emergency professionals must possess ethical, physical, and mental characteristics to perform their jobs effectively. These characteristics are necessary in emergency situations where quick thinking and decisive action can make all the difference.

To know more about mental characteristics visit:

https://brainly.com/question/8011667

#SPJ11

What was the Court's position on redrawing congressional districts to promote minority interests?

Answers

The Court has generally recognized the need to protect minority voting rights in redrawing congressional districts. This recognition stems from the Voting Rights Act of 1965, which aims to prevent racial discrimination in voting practices.

However, the Court has also set limits on the extent to which redistricting can be done to promote minority interests.
In a series of cases, such as Shaw v. Reno (1993) and Miller v. Johnson (1995), the Court has held that redistricting based predominantly on racial considerations is unconstitutional under the Equal Protection Clause of the 14th Amendment unless it can be justified as a narrowly tailored remedy for past racial discrimination.

In other words, while promoting minority interests in congressional districts is an important goal, the Court has made it clear that this goal cannot be pursued at the expense of other constitutional principles, such as equal protection under the law.

To sum up, the Court's position on redrawing congressional districts to promote minority interests is that it is permissible, but only to the extent that it does not infringe upon other constitutional rights and is a narrowly tailored remedy to address past racial discrimination.

To learn more about  congressional districts, visit: https://brainly.com/question/27644952

#SPJ11

What is the STR found within the DNA sequence? TCATGCGATGATGATGATGATCGCT


A. CAT


B. GCG


C. ACG


D. GAT

Answers

The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.

In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.

It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.

Learn more about Short Tandem Repeat at:

brainly.com/question/29661522

#SPJ4

Suppose that, under a new city ordinance, police officers would have a choice when it comes to dealing with persons possessing less than four ounces of marijuana. relying on their discretion, officers could (a) arrest the offender, leading to possible jail time; or (b) write the offender a ticket, treating the infraction like a traffic violation. would this be a just and fair policy? would it make it easier or more difficult for police officers to protect the community? why or why not?

Answers

Under the proposed city ordinance, police officers would have discretion when dealing with individuals possessing less than four ounces of marijuana. They could either (a) arrest the offender, leading to possible jail time or (b) write the offender a ticket, treating the infraction like a traffic violation.

Whether this policy is just and fair depends on various factors, such as the potential for unequal treatment, the prioritization of law enforcement resources, and the impacts on the community. On one hand, allowing officer discretion could lead to inconsistencies and potential biases in how offenders are treated. On the other hand, treating minor marijuana possession as a traffic violation could reduce the burden on the criminal justice system and allow officers to focus on more serious crimes.

As for the impact on police officers protecting the community, this policy could make it easier for them to allocate resources more effectively and concentrate on higher-priority issues. However, if discretion is not applied consistently and fairly, it could create mistrust and tensions within the community. Ultimately, the success of this policy would depend on how effectively it is implemented and monitored.

To know more about the Illegality of Marijuana Possession- https://brainly.com/question/29800924

#SPJ11

When property is used to secure payment of a debt or obligation, a lien on the property is given by the borrower, who is called

Answers

When property is used to secure payment of a debt or obligation, a lien on the property is given by the borrower, who is called the debtor

Who is the debtor?

The creditor, who is the entity or individual that the debtor owes the debt or obligation to, is granted a lien on the property as security for the debt. This means that the creditor has a legal claim on the property, which can be used to satisfy the debt if the borrower fails to repay it.

The lien remains in effect until the debt is fully paid off or otherwise discharged according to the terms of the agreement between the debtor and creditor.

Learn more about debtor at https://brainly.com/question/19863258

#SPJ1

today, all of the courts in our country have have been unified and have both legal and equity jurisprudence. true false

Answers

The legal cure will take priority if neither party has been wronged and both are in an equitable position. The value will not give a precise cure on the off case that the two players have equivalent causes. The correct answer is true.

A Chancery Equity Court is authorized by law to apply the equity principle rather than the law to cases brought before it. The rules and principles that emerge from exercising residuary powers are the living foundation of the state's legal system.

Value is an overall set of laws for getting a fair outcome while existing regulations don't give an answer. A settled and formal body of substantive and procedural rules and doctrines that supplement, assist, or override common and statutory law is the English Chancery system of law.

To learn more about equivalent causes here

https://brainly.com/question/15016716

#SPJ4

Write a three- to five-page report explaining the process.

explain the agency and type of information you want to see and why. write down reasons that the information might not be available.
conduct a search to see if the information is already available. document your search.
if the information is not yet available, submit a foia request to that agency. document this process.
analyze the process—what worked, what didn’t work, why you think that is, etc.
if you receive the information (because it is already available or the government sends it to you) explain if the records you are seeing meet your expectations and why or why not.
if you have received the information and it is available online, provide a link. if not, provide a brief description of it. if the information was not yet available and you had to request it, include a copy of your request in the final report.

Answers

Introduction The Freedom of Information Act (FOIA) is a federal law that allows individuals to request access to government agency records. The FOIA provides transparency to the government’s activities and helps citizens to understand the government's decision-making processes. In this report, we will explain the process of submitting a FOIA request and provide an analysis of the process.

Agency and Type of Information

For this report, we are interested in obtaining information from the Environmental Protection Agency (EPA) related to the regulation of a particular chemical used in food packaging. Specifically, we want to see any records related to the EPA’s evaluation of the safety of the chemical and any correspondence between the EPA and the company that produces the chemical.

Reasons the Information Might Not Be Available

There are several reasons why the information we are interested in might not be available. The records could be classified or contain sensitive information that cannot be released to the public. Additionally, the records could have been destroyed or lost, or they could be in the process of being reviewed for release.

Conduct a Search

We first conducted a search of the EPA’s website to see if the information we were interested in was already available. We searched for keywords related to the chemical and the regulation of food packaging. However, we did not find any records that matched our search criteria.

Submit a FOIA Request

As the information we were interested in was not available, we submitted a FOIA request to the EPA. We submitted our request using the online FOIA portal provided by the agency. We provided a detailed description of the records we were seeking and why we were interested in them.

Analysis of the Process

The process of submitting a FOIA request was relatively straightforward. The online FOIA portal provided by the EPA was easy to use, and the instructions were clear. However, the process of receiving a response from the agency can be lengthy. The EPA has 20 business days to respond to a FOIA request, but this timeline can be extended in certain circumstances.

To learn more about  Reporters  here

https://brainly.com/question/27937774

#SPJ4

Why is it a good idea to physically prepare before you go into training to be a firefighter?
it is simply good to be in good share for anything.
there is nothing more difficult than the physical fitness test for firefighters.
if you do not pass the physical fitness test, you can take it many times until you pass.
the more you know about the firefighter tests the more you may be able to get by with just the written aptitude tests

Answers

It is highly recommended to physically prepare before beginning training to become a firefighter. This is because firefighting is a physically demanding job that requires strength, endurance, and agility. By preparing your body through exercise and conditioning, you can reduce your risk of injury and increase your overall performance during training and on the job.

Additionally, passing the physical fitness test is a requirement for becoming a firefighter, and being in good physical shape will give you a better chance of passing on your first attempt. By focusing on your physical fitness, you may also be able to excel in other areas of the firefighter tests, such as the written aptitude tests. In summary, physical preparation is crucial for success in firefighting training and on the job.

Learn more about why firefighters shall be physically fit? https://brainly.com/question/8861088.

#SPJ11

how do courts generally rule in cases involving ambiguous contract language that makes it unclear what is being assigned or delegated?

Answers

The court typically considers the assignment to be of both rights and duties when ambiguous language is used.

The court will look beyond the language of the contract itself to resolve the ambiguity and enforce the contract if a trial judge finds that a contract contains an ambiguity—that is, the contract or a provision within the contract is open to two or more reasonable interpretations.

A court will typically interpret ambiguous contract terms in favor of the agreement's author. However, this rule only applies when one contracting party has a stronger bargaining position, typically due to greater experience or legal representation.

Contra proferentem is a standard of agreement understanding that expresses an equivocal agreement term ought to be interpreted against the drafter of the agreement.

To learn more about ambiguous language here

https://brainly.com/question/28188050

#SPJ4

discuss the purpose of aggravating factors in a disciplinary hearing

Answers

Aggravating factors are used in a disciplinary hearing to provide a clearer understanding of the severity of the offence committed by the accused. They are used to highlight any factors that may have contributed to the offence being committed or any actions taken by the accused that may have worsened the impact of the offence. The purpose of aggravating factors is to ensure that the disciplinary action taken is appropriate and proportionate to the offence committed, ensure that justice is served and promote a healthy and productive work environment.

The purpose of aggravating factors in a disciplinary hearing is to:
1. Highlight the seriousness of the offence: Aggravating factors emphasize the severity of the misconduct and help the decision-maker understand the potential impact it has on the organization or individuals involved.
2. Determine the appropriate disciplinary action: By considering aggravating factors, decision-makers can ensure that the disciplinary action taken is proportionate to the offence committed and the circumstances surrounding it.
3. Ensure consistency in disciplinary procedures: Aggravating factors help maintain fairness and consistency by providing a framework for considering and evaluating the severity of different offences in disciplinary hearings.
4. Discourage repeat offences: The inclusion of aggravating factors in disciplinary hearings serves as a deterrent to potential repeat offenders, as they are made aware of the serious consequences that may result from their actions.

In summary, aggravating factors in a disciplinary hearing serve to highlight the seriousness of the offence, determine appropriate disciplinary action, ensure consistency in disciplinary procedures, and discourage repeat offences.

Learn more about the person accused of a crime: https://brainly.com/question/31229571.

#SPJ11

John Falstaff and Revere Furniture Company groups: 1. What are the strongest legal arguments in favor of your side’s position? (You must include statutory and case law to support your arguments. )

Answers

The strongest legal argument in favor of Falstaff is that the terms of the partnership agreement were not met by Revere.

The agreement stated that all partners must contribute to the capital, and Revere failed to do so. This would be a breach of contract, as stated in the Uniform Partnership Act section 14-106 (1). Additionally, Falstaff could argue that Revere acted in bad faith by going against the terms of the agreement and not contributing to the capital.

This could be supported by case law such as Cohen v. Cowles Media Co., 479.N.W.2nd.194 (Minn. 1992). Furthermore, Revere’s attempts to take control of the company could be in violation of the fiduciary duties of a partner, which could also be supported by case law such as Korn v. Korn, 611.N.Y.S.2d. 864 (N.Y. 1994).

To know more about Falstaff , click here:

https://brainly.com/question/31479256

#SPJ4

At a crime scene you find a piece of glass with a red, dried liquid, and a yellow fiber on the edge lying on the ground. Upon closer inspection, you notice


that there is also a smudged fingerprint crossing the center of the glass. Explain how you would collect, preserve and analyze all of this evidence. What


would you hope to find out from each piece of evidence? Indicate whether the glass, red liquid, fingerprint and yellow fiber are Individual or Class


evidence and discuss why.

Answers

The process of collecting, preserving, and analyzing evidence at a crime scene is called forensic investigation. The process involves identifying, preserving, analyzing, and documenting evidence.

The collection of evidence should be detailed enough to include as many relevant clues as possible but at the same time, sufficiently selective not to hinder the laboratory analysis.

Evidence always keeps up the quality when preserved in its initial condition as it was obtained from the crime scene. Whenever evidence is submitted in the court as an exhibit, the officials should establish the continuity of possessions of the evidence, which in legal terms is known as the chain of custody.

In your case, you would collect the glass with red liquid and yellow fiber on the edge lying on the ground and a smudged fingerprint crossing the center of the glass. You would preserve each piece of evidence separately to avoid contamination. You would analyze each piece of evidence separately to find out what happened at the crime scene. The glass could be analyzed for fingerprints or DNA. The red liquid could be analyzed for blood or other substances. The yellow fiber could be analyzed for its composition or origin.

The glass and red liquid are individual evidence because they can be traced back to a single source. The fingerprint and yellow fiber are class evidence because they cannot be traced back to a single source.

Learn more about the chain of custody:

https://brainly.com/question/28699126.

#SPJ11

Sarah grows rosebushes that she decided to sell online. She ships them using an airline. Does the airline carrier owe Sarah a duty to deliver her goods (the rosebushes) properly?



No, proper delivery is not the duty of the airline carrier.


No, proper delivery is not the duty of the airline carrier.



Yes, proper delivery is the duty of the airline carrier.


Yes, proper delivery is the duty of the airline carrier.



No, proper delivery is the duty of the seller.


No, proper delivery is the duty of the seller.



No, proper delivery is the duty of the consumer

Answers

Yes, proper delivery is the duty of the airline carrier is the correct answer which is option C

When Sarah decides to ship her rosebushes using an airline carrier, the airline carrier assumes the responsibility of delivering the goods to the intended destination in a safe and timely manner. This is known as the duty of care, which is a legal obligation that requires the airline carrier to exercise reasonable care in handling and transporting the goods. If the airline carrier fails to deliver the goods properly, Sarah may have a legal claim for damages against the carrier.

Option C is correct

To know more about delivery,  here

https://brainly.com/question/21840716

#SPJ4

members of congress fill all of the following roles except that of:
a. cabinet members
b. legislature
c. committee member
d. servant of the constitution

Answers

Members of congress fill all of the following roles except that of Cabinet members. The correct option is a.

The Cabinet is made up of appointed leaders of executive departments who offer the President policy advice. On the other hand members of Congress are elected officials who work in the legislative branch of government and are in charge of passing laws and standing up for their constituents.

As part of their duties in the government, members of Congress participate in committee work and have a responsibility to uphold the Constitution. Congressmen are the Constitution's servants. They swear under penalty of perjury to uphold and protect the US Constitution from all enemies both domestic and foreign. The correct option is a.

Learn more about Cabinet members at:

brainly.com/question/11131513

#SPJ4

It is a general rule that a foetus is not a legal subject (does not have rights, duties, and capacities). the south african law applies the nasciturus fiction as a legal exception to this rule. discuss the application of the nasciturus fiction as a legal exception in the light of exparte bodel steenkamp 1962 (3) sa 954 (o). write a legal article to discuss this statement and also refer to other applicable case law and other sources of law in the subject.

Answers

A legal theory in South African law known as the nasciturus fiction,  that recognizes the fetus as a legal subject for particular purposes. It is based on the notion that a fetus in utero is assumed to have been born for all purposes provided that it is subsequently born alive and advantageous to it.

As opposed to being a rule of law, the nasciturus fiction is a legal presumption that can be disproved by evidence. Exparte Bodel Steenkamp, a case where the unborn child had a right to inherit from its mother's estate, is one instance where this is acknowledged in South African case law.

The nasciturus fiction is also acknowledged in South African legal statutes, such as the Intestate Succession Act, which states that a child born alive after the death of an intestate person who was conceived before their death is entitled to inherit from their estate. An example of how the nasciturus fiction has been used in South African law is the case of Exparte Bodel Steenkamp 1962 (3) SA 954 (O).

Learn more about Succession Act at:

brainly.com/question/12408045

#SPJ4

a mother executes a deed stating that upon her death the property will convey to her son, abraham lacey. the mother created which type of estate?

Answers

A mother signs a deed stating that her son, Abraham Lacey, will inherit the property upon her death. A specific kind of life estate was created by the mother. The correct answer is (D).

If a woman's mother acquires a property through her will, gift, inheritance, or self-acquired property, she becomes the sole owner. The Hindu Succession Act of 1956 (the Act) governs how a mother's property is divided according to Hindu law. Intestacy succession is covered by the Act.

The mother cannot dispose of the ancestral property she received in accordance with her will. Therefore, you may challenge and request a portion of that. If the gift deed was signed under questionable circumstances, you can challenge it. Otherwise, the mother can sign a registered gift deed to transfer her assets to anyone.

To learn more about life estate here

https://brainly.com/question/30761355

#SPJ4

Q- A mother executes a deed stating that upon her death the property conveys to her son, Abraham Lacey. The mother created which type of estate?

a) Estate in revision

b) Estate for years

c) Nonfreehold estate

d) a Life estate




Thomas Pogge proposes a "global resource dividend" as one aspect of



a. A global scheme for wealthy nations to use cheap labor from developing countries.



b. A global scheme for affluent nations and citizens of affluent nations to compensare the poon



c. A global scheme for affluent nations to buy commodities from the poor



d. A global pyramid scheme for affluent nations to further exploit the poon

Answers

Thomas Pogge proposes a "global resource dividend" as one aspect of a global scheme for affluent nations and citizens of affluent nations to compensate the poor. Hence, Option b) is the correct answer.

According to Pogge, the resources of the world are not distributed fairly, and as a result, the poorest nations suffer the most. The global resource dividend is a way to address this issue by redistributing the profits of natural resources, such as oil and gas, to the people of poor countries.

Pogge argues that this is a moral obligation of wealthy nations, as they benefit from the exploitation of resources in poor countries. By sharing the profits with the people of those countries, the global resource dividend can help to reduce poverty and inequality. The scheme is not a way to exploit the poor further or to buy commodities from them, but rather a way to provide compensation for the exploitation that has already occurred.

The global resource dividend is a way to promote justice and fairness in the global economy and to ensure that the benefits of natural resources are shared more equitably.

To learn more about natural resources, visit: https://brainly.com/question/13354731

#SPJ11

how to get guardianship of a child without going to court

Answers

By signing some paperwork saying that you agree to have someone else as the guardian of the child.
Other Questions
A, B and C form the vertices of a triangle.BC = 6.9cm and CBA = 137.Given that the area of the triangle is 12.6cm2, calculate the perimeter of the triangle rounded to 1 DP Suppose z = x+ sin(y) , x = 2t = - 482, y = 6st. - 1 A. Use the chain rule to find z as and Oz as functions of z t X, Y, s and t. - az s/z as/z B. Find the numerical values of and o" the product, diphenylacetylene, is only sparingly soluble in diethyl ether. why is the addition of water preferable to adding diethyl ether as a means of precipitating the product for isolation by filtration? Eddie's dog weighs 31. 8 kilograms. How many grams are equivalent to 31. 8 kilograms?A). 0318 gramsB) 318 grams() 3,180 gramsD) 31,800 grams Of the following is a political impact of the widespread unemployment during the Great Depression? Erica spins a spinner with equal sections numbered 1 through 4 and selects a colored tile from a bag. Based on the tree diagram given, what is the probability of spinning a 2 or 3 on the spinner and drawing a blue tile? the critical new developments in telescopes. Write a 200 word paper on the new developments. answer options:x= 3, -4x= 5, -1x= 0, 5x= 1, 5 The coiling dragon cliff skywalk in china is $128$ feet longer than the length $x$ (in feet) of the tianmen skywalk in china. The world's longest glass-bottom bridge, located in china's zhangjiaji national park, is about $4. 3$ times longer than the coiling dragon cliff skywalk. Write and simplify an expression that represents the length (in feet) of the world's longest glass-bottom bridge What volume of each solution contains 0. 12 mol of KCl? Answer in litersPart A 0. 211 M KClPart B 1. 7 M KClPart C 0. 855 M KCl Write the explicit formula for the following sequence, then generate the first five terms. A1 = 256, r = 0. 25 You hear about a magnitude 8. 0 earthquake on the news. Someone says "That doesn't sound too bad. An 8. 0 is just one more than the 7. 0 we had here last year. " Explain why that's not the right wayto think about the moment magnitude scale discuss the key characteristics of the plot. consider the points when potential energy u is maximum, u is minimum, kinetic energy k is maximum, k is minimum and when u and k are the same value. what is the significance of these points? The food company is now designing soup boxes. The largest box of soup will be a dilation of the smallest box using a scale factor of 2. The Smallest box hold 8 fl oz or about 15 cubic inches of soup find a set of dimensions for the largest box? round your answer to the nearest tenth if necessary .Which later quote from the story confirms your answer to Part A? PLEASE SOMEONE !! 15 POINTS!!! Kevin works 3z hours each day from Monday to Friday. He works (4z-7) on Saturday. Kevin does not work on Sunday. Find the number of hours Kevin works in one week in terms of z What is the impact of Coriolis force and latent heat on the development of cyclone Ana? Were there laws in the US that would allow the courts to grant Marbury paperwork? Assignment! Please research "How Did BeowulfDie" Please write 15 Sentences relating to the death ofBeowulf making comparison to Anglo Saxon Funerals.