In given pedigrees II-1 heterozygous because the man (II-1) that brown-eyed woman marry has brown eye but they have a son (III-1) with blue eye. So, genotype of II-1 will be Bb.
What is pedigrees?A family tree diagram that makes use of standardized symbols. The relationships between family members are shown in a pedigree, which also identifies the members of a family who have particular genetic pathogenic variants, traits, and diseases as well as their current health.
Pedigrees are typically employed to illustrate straightforward dominant and recessive traits. Having a widow's peak hairline, for instance, is dominant. If someone possesses that quality, their pedigree symbol will be shaded in.
To know more about Pedigrees visit:
https://brainly.com/question/13667608
#SPJ1
the basic unit of all life. contains organelles the work together to maintain homeostasis within the organism.
Answer: the cell
Explanation:
Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash
Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.
Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.
Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.
Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.
Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.
Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.
Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.
Learn more about Biomass at :
https://brainly.com/question/21525417
#SPJ4
Complete question:
1.plants
2.animals
3.animal waste
4.sunlight
5.paper
6.trash
Do plants absorb nitrogen?
Answer:
No, not absorb nitrogen.
yes. plants absorb nitrogen through soil
B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas
Answer:
B) A. FALSO.
B. VERDADERO.
C. VERDADERO.
D. VERDADERO.
c) D. Contracción de los bronquios.
d) A. Axon, dendritas, cuerpo neuronal.
Explanation:
B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.
B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.
C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.
D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.
c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:
D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.
d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:
A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)
A boy is riding a bike. If there were NO friction between the tires and the ground and NO air resistance, the boy would:()
Answer:
Friction is what makes the bike move forward. If there was no friction between the bike's wheels and pavement, the tires would just spin in place and the energy you put into pedaling would not translate into forward motion. ... Likewise, you could not stop without the friction of the brakes and the tires.
Explanation:
Which one of the following is not an environmental problem at the Chesapeake Bay?
a. Algal bloom
b. Man-made pollution
c. Increase in tidal wetlands and wild rice vegetation
d. Depletion of oysters that serve as natural water filters
Answer:
c
Explanation:
it's the only one that makes sense with the info you provided. it is the only answer that would seem to NOT cause environmental harm
Increase in tidal wetlands and wild rice vegetation is not an environmental problem at the Chesapeake Bay.
What is environmental problems?"It is the harmful effects of human activities on the environment."It includes: global warning, increasing pollution, overpopulation, climatic change, etc.Chesapeake Bay is an estuary located in USA. The main problems associated with this is:
Increase nitrogen and fertilizers in water bodies can cause algal bloom.Accumulation of animal and human waste.Reduction in the number of oysters.Wetland destruction.Rise in water level.Hence, the correct option is c. Increase in tidal wetlands and wild rice vegetation.
To learn more about environmental problems here
https://brainly.com/question/13254082
#SPJ2
Part D: Consider Constraints
What limitations will there be to building an eco-friendly home in this neighborhood? Consider social, financial, and climate constraints while determining these limitations.
Social constraints such as zoning regulations and community resistance, financial constraints such as the cost of materials and labor, and climate constraints such as the availability of renewable energy resources and the local weather patterns.
What are limitations of eco-friendly home?Eco-friendly homes may have limitations such as higher initial costs for construction or retrofitting, limited availability of certain materials and technologies, and a lack of standardization in building codes and regulations.
Additionally, some eco-friendly features, such as solar panels or green roofs, may not be suitable for all climates or may require regular maintenance. It's also worth noting that eco-friendly homes can be more energy-efficient but they may not be able to produce all the energy they need and they may still rely on grid energy.
Learn more about eco-friendly home, here:
https://brainly.com/question/8626176
#SPJ1
Pls help. I have no brain cells at this point-_-
This is a response of the immune system to a substance it incorrectly identifies as a
foreign pathogen.
A.humoral
B.immunity
C.antigen
D.allergies
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
Answer:
The complementary base pair is ATG TTT GTG ATA TGG CGC ATT TAC TAA
Explanation:
As per the complementary base pairing rule of DNA
C pairs with G and vice versa
A pairs with T (in DNA) or U (in RNA)
Breaking the given strand into triplets, we get -
TAC AAA CAC TAT ACC GCG TAA ATG ATT
ATG TTT GTG ATA TGG CGC ATT TAC TAA
On irreversible effect of both deforestation and water pollution on the environment is the -
A- extinction of species.
B- thinning of the ozone shield.
C- depletion of the atmospheric carbon dioxide levels.
Which of the following is true of biogeochemical cycles?
Explanation:
The carbon, oxygen, and nitrogen cycles are all biogeochemical cycles. They show the movement of elements through living and nonliving components of the Earth. Carbon, oxygen, and nitrogen, are essential components of life that pass through organisms and nonliving components, but are never used up.
Quorum-sensing contributes to the ability of bacterial colonies to congregate into nearly solid masses which act as barriers to effective decontamination and sterilization called:
Biofilms are formed when bacteria congregate into a nearly solid mass. This occurs when bacteria use quorum sensing to communicate with each other and create pathways for cells to attach to and form a matrix.
The matrix shields the cells from external forces and helps to protect the bacteria from antibiotics, desiccation, and extreme temperatures. Biofilms can form on just about any surface, including medical and surgical instruments, water pipes, and even on the surfaces of plants and animals.
The formation of biofilms makes it difficult to decontaminate and sterilize, since the bacteria are protected within the matrix and can withstand harsh chemicals and extreme temperatures. Biofilms are also highly resistant to antibiotics, making them difficult to eradicate.
To learn more about antibiotics visit:
https://brainly.com/question/10868637
#SPJ4
interactions between the red blood cells and important molecules, cells, and organs in the heart
Answer:
Gardos channel-mediated interactions with other cell types are indirect and often mediated by two other membrane proteins: PIEZO1 and an other unknown receptor. An example is the ability of RBC to change their ratio shape/volume to pass through narrow capillaries and interstices
Which two statements describe force?
Answer:
b........................
I need someone to explain this
Antigen presenting cells in the human immune system work with T cells to kill invading pathogens (bacteria and viruses). Antigen presenting cells will identify the pathogen and present the antigen, which is a unique protein "name tag" of the pathogen, to the T Cell so that the T cell can find and kill the pathogen. This type of communication between the antigen presenting cell and the T cell is known as.
a. Direct contact b. Local signaling c. Long distance signaling d. Transduction signaling
This type of communication between the antigen presenting cell and the T cell is known as Transduction signaling, hence the correct option is d.
The act of a cell showing an antigen bound by major histocompatibility complex (MHC) proteins on its surface is known as antigen presentation, sometimes known as antigen presentation. Antigen presenting cell process antigens before they are presented to T cells. Antigens can be expressed in some form by almost all cell types. While cells that are infected with viruses (or cancer cells) can offer cytotoxic T cells with antigens that originate inside the cell, professional antigen-presenting cells, such as macrophages, B cells, and dendritic cells, provide helper T cells with exterior antigens. They may be found in several types of tissues. Through their T cell receptors, T cells may be able to recognise these complexes (TCRs).
To learn more about Antigen presenting cell click on the given link: https://brainly.com/question/13588471
#SPJ4
in details the steps for blood clotting in response to an injury
The boatbill is present in a density of at least one pair per 20 acres at the same time that two different types of plants are dominant. What are these plants?
A. Weeds and grasses
B. Grasses and Shrubs
C.Shrubs and small trees
D. small trees and canopy trees
The two types that the boatbill will dominate are grasses and shrubs according to the attached table. So the correct option is B.
What is the boatbill?The boatbill is a type of bird genus that will be predominantly in grasses and shrubs. They can change the composition of these areas as time passes. This type of bird will feed mainly on insects, cicadas being the main ones in its diet. They can also feed on small fish or small animals such as lizards. But its main diet is not other animals but it can also feed on fruits.
As for its reproduction, the female will be in charge of building the nest with sticks and herbs that the male will provide. Once the nest is formed, the female will lay her eggs in it and the incubation period will be given so that the chicks leave this and after a certain time, leave the nest.
Therefore, we can confirm that the correct option is B. grasses and shrubs.
To learn more about birds visit: https://brainly.com/question/25120645
#SPJ1
Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.
Answer:
Yes they are wrong
Explanation:
I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.
What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses
Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.
What are genes and what do they do?A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.
What are the four primary roles of genes?Gene functions include:
Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.Learn more about gene functions to visit this link
https://brainly.com/question/8334911
#SPJ4
Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?
Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.
Many viruses specifically methylate protective genes, thus enhancing viral infectivity.
Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.
Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.
How does the image of the dead bird wrapped in a silk cloth strengthen the feminist theme?
The bird represents Mrs. Wright's loneliness during her marriage to Mr. Wright.
Susan Glaspell's Trifles is a one-act drama. On August 8, 1916, the Provincetown Players staged it at the Wharf Theatre in Provincetown, Massachusetts. Glaspell portrayed Mrs. Hale in the original production. The drama is regularly anthologized in textbooks of American literature. The play, written during the first wave feminist movement, contrasts how women act in public and in private, as well as how they perform in front of other women vs males.
Through the absence of its main character, Mrs. Wright, Trifles addresses the issue of identity. Glaspell reveals how a person's identity is "just as much created as innate" by leaving this figure off stage. Mrs. Wright can only be perceived by the audience via the lens of the on-stage characters as they review and debate her personal life and alleged crime, and these characters may not all perceive Mrs. Wright in the same way. The spectator gets a well-rounded image of Mrs. Wright and how her identity is flexible and evolves based on the preconceptions of the other characters from the group in the farmhouse.
To learn more about Trifles, here
brainly.com/question/30125129
#SPJ4
Ile Faller is of inheritance
Read each of the sentences that describe a physical change. Drag each sentence into the correct box.
Coat color in rabbits is expressed with four different phenotypes by a single gene. - This is an example of multiple alleles.
The trait of coat color is determine by one gene, but 4 different variants in that gene produce 4 different phenotypes.
When a certain variety of black chicken is crossed with a white chicken, all of the offspring are checkered. Black and white feathers are produced in the offspring. This is an example of codominance - When black and white chickens are crossed, they produce heterozygous chickens that are checkered. This heterozygous phenotype results in the expression of both traits, as both are expressed in the phenotype. Then, when the heterozygotes are crossed, the homozygous black and white chickens and be produced again. If it was incomplete dominance, we would expect the rabbits to be grey.
The F1 generation produced by a cross between red-flowered (RR) and white-flowered (r) Four O clock plants consists of pink colored flowers - this is an example of incomplete dominance, which is characterised by a blending phenotype, where one allele is not fully dominant over the other. If it was codominance, we would expect stripes or spots of both red and white.
The distribution of plant heights forms a bell-shaped curve with intermediate heights occurring most often. - this is an example of polygenic traits. Height is usually not controlled just by one gene, instead it is the result of the action of several different genes that have small effects on the phenotype.
Leaves on a tree can have different sizes and shapes depending on the amount of light they receive. This is an example of environmental influence on gene expression - the light is an environmental factor that influences what and how genes are transcribed, producing effects on leaf shape.
Genetic disorders in human mitochondrial DNA follow non. Mendelian patterns of inheritance - this is an example of maternal inheritance. Mitochondrial DNA is only inherited from the mother, this is because during fertilization, the egg cell is so much larger than the sperm cell and contains so many more mitochondria. And this is the source of where all the mitochondria arise.
Your question is incomplete most probably your full question was
Read each of the sentences that describe a physical change. Drag each sentence i into the correct
Coat color in rabbits is expressed with four different phenotypes by a single gene.
When a certain variety of black chicken is crossed with a white chicken, all of the offspring are checkered. Black and white feathers
are produced in the offspring.
The F1 generation produced by a cross between red-flowered (RR) and white-flowered (r) Four o'clock plants consists of pink
colored flowers
8
33
3
1
L
I
=
TOT 3
TESTS
The distribution of plant heights forms a bell-shaped curve with internediate heights occurring most often.
Leaves on a tree can have different sizes and shapes depending on the amount of light they receive.
Genetic disorders in human mitochondrial DNA follow non. Mendelian patterns of inheritance,
a bell-shaped curve w
Genetic disorders in human mitoch
Incomplete dominance
Codominance
Multiple alleles
Polygenic traits Maternal inheritance
To look more about dominance click here
brainly.com/question/14053639
#SPJ4
What was the most significant conclusion that Mendel?
The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.
The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.
Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.
The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.
Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.
For more information on Mendel's experiment , visit :
https://brainly.com/question/30097040
#SPJ4
Complete question :
What was the most significant conclusion that Mendel drew from his experiments?
A There is considerable genetic variation in garden pea
B Traits are inherited in discrete units one from each parent
C Genes are composed of DNA
D Recessive genes occur as frequently as dominant ones.
how many gender are really there? I believe that there are two male and female but people say that there are like 50
I, and certain humans, not only think or believe but KNOW that there are only two. The end.
can some one help me ill give more points if its right. ill give like 50
Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.
Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway
Answer:
Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.
Explanation:
Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.
8. The table below shows the number of generations required to produce white
butterflies through natural selection Calculate the mean, or average, number
of generations it takes to produce white butterflies.
Answer:
mean is 44.8
median is 36
Range is 32
Explanation:
hope it helps
stay safe love u
btw can i get brainliest
How has the world population changed in the last 200 years?
what is the ratio of 15 minutes to 2 hours
Answer:
15mins : 2 hrs
15 mins : 120 mins
1 : 8
Answer:
1:8
Explanation:
Convert 2 hours to minutes:
60*2 = 120 minutes
15/120 = 1:8
4 elements that are never found in nature and only made by people
Answer: Halogen Family
The elements in this family are fluorine, chlorine, bromine, iodine, and astatine.
They are the most active non-metals. They are never found free in nature.
They react with alkali metals to form salts.
Explanation:
The human genome project was able to map the human genome and it is now
completed. Why is this important in science?
Answer:
What is the Human Genome Project? The Human Genome Project was the international research effort to determine the DNA sequence of the entire human genome. In 2003, an accurate and complete human genome sequence was finished two years ahead of schedule and at a cost less than the original estimated budget.
Explanation:
The finished sequence produced by the Human Genome Project covers about 99 percent of the human genome's gene-containing regions, and it has been sequenced to an accuracy of 99.99 percent.