Disturbances in memory, consciousness, or identity are symptoms of:
A. affective disorders.
B. anxiety disorders.
C. dissociative disorders.
D. somatoform disorders.

Answers

Answer 1
dissociative disorders
Answer 2

Disturbances in memory, consciousness, or identity are symptoms of dissociative disorders. Thus, option C is correct.

What is wellness?

The term wellness is defined as the characteristic or quality of being in good and finer health, mental, as well as social well being. Wellness is basically being in bestest physical and mental as well as social health.There are several types of wellness which includes spiritual wellness in which people feel to sacrifice for the love of the nation, and for others too.

Emotional wellness is the main type of wellness that applies to awareing and accepting the reaction of people. Physical wellness is the type of wellness in which you are physically fit and healthy and free from diseases. Multiple disorders has been includes the affective disorders, anxiety disorders, dissociative disorders, and somatoform disorders are found in many people and these leads to serious health issues.

Therefore, Disturbances in memory, consciousness, or identity are symptoms of dissociative disorders. Thus, option C is correct.

Learn more about wellness here:

https://brainly.com/question/18580902

#SPJ2


Related Questions

How do ocean currents transport heat around the earth?

Answers

Answer:

Ocean currents act as conveyor belts of warm and cold water, sending heat toward the polar regions and helping tropical areas cool off, thus influencing both weather and climate. ... The ocean doesn't just store solar radiation; it also helps to distribute heat around the globe.

Hope I helped you! <3Miss Hawaii

Explanation:

Your answer is -, sending heat toward the polar regions and helping tropical areas cool off

Identify and investigate the properties of minerals. Identify and classify a variety of rocks.
based on physical characteristics from their origin, and explain how they are related using the
rock cycle. (i.e. Sedimentary, igneous, and metamorphic rocks)

Answers

Answer:

Igneous rocks are classified on the basis of their composition and their texture. Magma, and the igneous rock it becomes, has a range of chemical compositions. For example, basalt is a mafic lava flow rock which originates from melting of the upper mantle.

Explanation:

Answer:

There are three main types of rocks: sedimentary, igneous, and metamorphic. Each of these rocks are formed by physical changes—such as melting, cooling, eroding, compacting, or deforming—that are part of the rock cycle. Sedimentary rocks are formed from pieces of other existing rock or organic material.

Explanation:

Hope This Helps!

What macromolecules and biomolecules are critical for
cellular respiration to occur?

Answers

Answer:

Glucose

Explanation:

Glucose is the molecule that is needed for cellular respiration. The glucose monomer is also a building block for carbohydrate polymers such as starch, glycogen and cellulose. Proteins have a number of important functions. These include their roles in structures, transport, storage, hormonal proteins and enzymes.

I HoPe ThiS HeLpS!!!!

2. How are the atmosphere, hydrosphere, and lithosphere related in the
biosphere?

Answers

Answer:

For example, rain (hydrosphere) falls from clouds in the atmosphere to the lithosphere and forms streams and rivers that provide drinking water for wildlife and humans as well as water for plant growth (biosphere). River action erodes banks (lithosphere) and uproots plants (biosphere) on the riverbanks.

Explanation:

Hope this helps.

true or false

ATP is the primary source for energy for cells.

Answers

Answer:True

Explanation:The mitochondria is the powerhouse of the cell and it converts chemicals that you get from food into ATP.  ATP is then shipped out and used for energy.  Hope this helps:D

I need help now please

Answers

Answer:

c i think

Explanation:

sorry if im wrong

Wastewater treatment plants can make wastewater drinkable again. Which of
the following is a technology used to remove solids from the water?
O A. Treating the water with certain bacteria and air
O B. Shaking and skimming them from the surface of the water
O c. Adding hydrochloric acid and chlorine to the water
O D. Filtering and allowing them to settle out of the water
SUBMIT

Answers

Answer:

D

Explanation:

I'm not 100% sure this is right but it's a better answer than B

A concentration gradient affects the direction that solutes diffusion. Describe how molecules move with respect to the concentration.

Answers

Answer:a

Explanation: took it

Answer:

If a concentration gradient exists, molecules will move from areas of high concentration to areas of low concentration until the concentration gradients have equalized

Explanation:

I don't really have an explanation but there's the CORRECT answer.

Differentiate betweeli population density and
population distribution.

Answers

Answer:

The main difference between population density and population distribution is that the population density is the number of individuals per unit land whereas the population distribution is the spreading of people over an area of land. Furthermore, population density is unable to describe where the population actually lives, unlike population distribution.

Population density and population distribution are two measurements of population used in a variety of applications in ecology.

Explanation:

What ocean resource may be harvested by vaccuming or trawling

1:fish

3:minerals

4:fuels
Serious answers only or I will report 15 points btw

Answers

Answer: A, fish. Fish may be harvested by vacuuming or trawling.

cuales son los efectos del compost en el crecimiento de la lechuga

Answers

Answer:

Los resultados mostraron que el compost orgánico producido presentó características físico-químicas y microbiológicas dentro de los rangos de utilización agronómica y su adición en el sustrato de fibra de coco, favoreció la producción de lechuga, promoviendo un incremento de 63% en la altura de plantas

Explanation:

HURRY PLS

A student observes a plant cell and an animal cell under a microscope. he records the following observations.

Answers

Answer:

I think it's A.

Explanation:

If you look at the chart, responses to water loss or gain doesn't change the plant cell at all. But if you look at the animal cell, if it gains or loses water, it shrinks or increases in size depending on what happened. Plus, I think it's really the only answer choice that makes sense given the whole table and then looking at the other answers that don't really fit in with the descriptions.

Answer: its a

Explanation:

AMP-PNP is a non-hydrolyzable ATP analog that cannot be metabolized by cells. Taurocholate is a bile acid that helps emulsify fats. When taurocholate is added to hepatocyte cell culture, it accumulates in those cells. The graph below shows the rate of cellular accumulation of the drug taurocholate in the presence of either no ATP, ATP, or AMP-PNP. Based on this data, describe the mechanism by which taurocholate enters the cell. Justify your answer.

Answers

Answer:

ATP plays a critical role in the transport of macromolecules such as proteins and lipids into and out of the cell. The hydrolysis of ATP provides the required energy for active transport mechanisms to carry such molecules across a concentration gradient.

Explanation:

ATP plays a critical role in the transport of macromolecules such as proteins and lipids into and out of the cell.

What is ATP?

A vital "energy molecule" present in all living things is adenosine 5′-triphosphate, also known as ATP and typically written without the 5′-. In particular, it is a coenzyme that transfers energy to cells by releasing its phosphate groups when it interacts with enzymes like ATP triphosphatase.

Particular to plants and cyanobacteria is the process of photophosphorylation. During photosynthesis, it is the conversion of ADP to ATP utilizing solar energy. In the mitochondria of a cell, the process of cellular respiration also results in the formation of ATP.

This can be done through either anaerobic or aerobic respiration, depending on whether oxygen is present.

Therefore, ATP plays a critical role in the transport of macromolecules such as proteins and lipids into and out of the cell.

To learn more about ATP, refer to the link:

https://brainly.com/question/14637256

#SPJ5

NAME 3 SIMILARTIES AND 3 DIFFERENCES BETWEEN EACH OF THESE ZONES (AT LEAST 1 ABOTIC AND 1 BIOTIC FACTOR FOR EACH)

Sublittoral Zone & Epipelagic Zone

Abyssopelagic Zone & Hadalpelagic Zone

Neritic Zone & Oceanic Zone

Bathyal Zone & Bathypelagic Zone

Euphotic Zone & Aphotic Zone

Answers

Answer:

Like terrestrial biomes, aquatic biomes are influenced by a series of abiotic factors. The aquatic medium—water— has different physical and chemical properties than air. Even if the water in a pond or other body of water is perfectly clear (there are no suspended particles), water still absorbs light. As one descends into a deep body of water, there will eventually be a depth which the sunlight cannot reach. While there are some abiotic and biotic factors in a terrestrial ecosystem that might obscure light (like fog, dust, or insect swarms), usually these are not permanent features of the environment. The importance of light in aquatic biomes is central to the communities of organisms found in both freshwater and marine ecosystems.  

Explanation:

The ocean is categorized by several areas or zones (Figure 1). All of the ocean’s open water is referred to as the pelagic zone. The benthic zone extends along the ocean bottom from the shoreline to the deepest parts of the ocean floor. Within the pelagic realm is the photic zone, which is the portion of the ocean that light can penetrate (approximately 200 m or 650 ft). At depths greater than 200 m, light cannot penetrate; thus, this is referred to as the aphotic zone. The majority of the ocean is aphotic and lacks sufficient light for photosynthesis. The deepest part of the ocean, the Challenger Deep (in the Mariana Trench, located in the western Pacific Ocean), is about 11,000 m (about 6.8 mi) deep. To give some perspective on the depth of this trench, the ocean is, on average, 4267 m. These zones are relevant to freshwater lakes as well.

The ocean is the largest marine biome. It is a continuous body of salt water that is relatively uniform in chemical composition; it is a weak solution of mineral salts and decayed biological matter. Within the ocean, coral reefs are a second kind of marine biome. Estuaries, coastal areas where salt water and fresh water mix, form a third unique marine biome.

The intertidal zone, which is the zone between high and low tide, is the oceanic region that is closest to land (Figure 2). Generally, most people think of this portion of the ocean as a sandy beach. In some cases, the intertidal zone is indeed a sandy beach, but it can also be rocky or muddy. Organisms are exposed to air and sunlight at low tide and are underwater most of the time, especially during high tide. Therefore, living things that thrive in the intertidal zone are adapted to being dry for long periods of time. The shore of the intertidal zone is also repeatedly struck by waves, and the organisms found there are adapted to withstand damage from the pounding action of the waves (Figure 2). The exoskeletons of shoreline crustaceans (such as the shore crab, Carcinus maenas) are tough and protect them from desiccation (drying out) and wave damage. Another consequence of the pounding waves is that few algae and plants establish themselves in the constantly moving rocks, sand, or mud.

What’s everyone’s favorite tv show or movie?

Answers

I dont watch tv shows or movies

lol

Who knows biology at the college level?

Answers

Answer:

I only know birds at a college level. Still studying. BY MYSELF

Explanation:

(FREE PONTS! JUST COPY AND PASTE THE ANSWER BELOW )

In which stage of the Calvin cycle does the plant cell produce energy for storage?
A. Regeneration
B. Carbon Fixation
C. Reduction <

This is the correct answer (COPY AND PASTE)
Reduction

Answers

Answer:

reduction

Explanation:

Answer:

CARBON FIXATION

Explanation:

A bell rolling across the foor keeps moving until it is stopped by friction. This example demonsszes
the work prindide
Newton's Second Law of Motion
Newton's Third Law of Motion
Nentor's First Law of Motion

Answers

answer
Newton’s second law of motion

Please help dont put down some answer please i will give you good review and lots of points.

Answers

Answer:

Planet Y

Explanation:

Planet Y has the smaller period because it takes less time to orbit the star. This is because it has less distance to travel compared to X.

YA'LL ARE SMART!! PLEASE HELP!!!

Answers

accelerating/speeding up!

Answer:

I believe your answer would be Accelerating/speeding up

Explanation:

If the bus was moving at a constant speed, the line would be flat

if the bus was slowing down, the line would decrease

if it was not moving, there would be no line

Explain the term “soil profile” (needs to be a paragraph)

Answers

Answer:

A soil profile is a vertical section of soil

Explanation:

Carbon dioxide is released as a byproduct of cellular respiration. Which one of these products is also formed during the metabolic reaction of cellular respiration? (B.9B)

Question 16 options:

Water


Glucose


Sucrose


Oxygen

Answers

The answer is oxygen

The product that is also formed apart from the carbon dioxide during the cellular respiration process is water. The correct option is A.

What is cellular respiration?

Cellular respiration is the process by which biological fuels are oxidized in the presence of an inorganic electron acceptor such as oxygen to produce large amounts of energy, which is then used to drive ATP production.

Cellular respiration is the process by which cells in plants and animals convert sugar into energy, which is then used to perform cellular work.

The goal of cellular respiration is straightforward is that it provides cells with the energy they require to function.

Carbon dioxide and water are the byproducts of cellular respiration. Carbon dioxide is exhaled from your lungs after being transported from your mitochondria to your red blood cells. ATP is produced during the process.

Thus, the correct option is A.

For more details regarding cellular respiration, visit:

https://brainly.com/question/13721588

#SPJ5

Where do light bulbs get their energy from?

Answers

Answer:

Light bulbs gets the energy from electricity which makes it light up.

I need help!!!!!!!!!

Answers

Answer:

bullet one

Explanation:

in a ribosomal protein

What role does concentration gradient play in movement across a cell membrane
in active transport?

Answers

Transport across a cell membrane is a tightly regulated process, because cell function is highly dependent on maintain strict concentrations of various molecules. When a molecule moves down its concentration gradient is it participating in passive transport; moving up the concentration gradient requires energy making it active transport.

Every year, 25 km 3 of sand is deposited on a beach by a nearby river, and 28 km 3 of sand is removed by wave action. Is the size of the beach increasing or decreasing? Explain your answer.

Answers

If 25 km3 of sand is deposited on a beach yearly and 28 km3 of sand is removed by wave action, the size of the beach would be decreasing, not increase.

First, there is a need to understand that the size of a beach is a function of the amount of sand deposited into it. The more the sand deposited, the more the beach would increase in size.

In this case, 25 km3 of sand is deposited annually but 28 km3 of sand is washed away by waves. The net amount of sand deposited can be calculated by subtracting the amount washed away by waves from the amount deposited. Thus

Net sand deposited = 25 - 28

                                     = -3 km3

Hence, the net amount of sand deposited annually is negative, meaning that the beach would decrease in size.

More on land formation can be found here:  https://brainly.com/question/469070

How cells make proteins quick check. Select the statement that is true

Answers

Answer:

In order for a cell to manufacture these proteins, specific genes within its DNA must first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into fully functional proteins.

In order for a cell to manufacture these proteins, specific genes within its DNA must first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into fully functional proteins.

What are proteins?

The protein molecules that the genes in DNA encode are the "workhorses" of the cell, performing all the tasks required for life. Proteins include, for instance, DNA polymerases and other enzymes that produce copies of DNA during cell division, as well as enzymes that metabolize nutrients and synthesize new cellular components.

The simplest definition of gene expression is the production of the gene's corresponding protein, and this complex procedure involves two main phases.

Transcription is the process by which the data in DNA is converted into a messenger RNA (mRNA) molecule in the initial phase. A pre-mRNA molecule is formed during transcription by an enzyme called RNA polymerase II using the DNA of a gene as a template for complementary base-pairing.

Therefore, In order for a cell to manufacture these proteins, specific genes within its DNA must first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into fully functional proteins.

To learn more about proteins, refer to the link:

https://brainly.com/question/17095120

#SPJ5


Rewrite the new sequence after the deletion of the "G" in position 3:
CCG.....UAG..... GUC.....CUG

Answers

Deletion is just the removal of one of the nucleotides. Therefore, the new sequence would be:

CCU...AGG...UCC...UG

(Basically everything moves over one)

Identify organelles in a plant cell with the diagram below.

Answers

Answer:

A - cloroplast

b- vacuole

c- cell wall

d- nucleus

Explanation:

I found the same picture online. I just looked up organelles in a cell plant and it was one of the first ones

Answer:

A - cloroplast

b- vacuole

c- cell wall

d- nucleus

Explanation:

i got the answers from this image (kepp this image because it might also help you) and please brainlest

Which of these plant cell structures is also found in a prokaryote?

A
B
C
D

Answers

If you could provide the choices for the answer options please?
Other Questions
PLEASE HELP :DDDDDDDDDD Find the volume of the rectangular prisim 6cm 4cm 12cm If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties.