for female cats

OO allele =

oo allele =

Oo allele =

Answers

Answer 1

Answer:

OO allele: Homozygous dominant allele, which codes for orange fur color.

oo allele: Homozygous recessive allele, which codes for non-orange fur color.

Oo allele: Heterozygous allele, which codes for orange fur color.


Related Questions

the hermann grid and mach band illusions are the result of . group of answer choices bilateral inhibition competitive exclusion lateral excitation lateral inhibition

Answers

Lateral inhibition A collection of receptors detects the visual field's presentation of objects.

Baumgartner proposed a classical explanation for the Hermann Grid illusion. As per this hypothesis, the deceptive impact is created by the reaction of retinal ganglion cells with concentric on-off or off-on responsive fields (because of horizontal hindrance).

Mach bands, the illusion that light and dark lines exist next to sudden changes in brightness, and the gray dots that appear between intersections in the Hermann grid illusion can both be explained by lateral inhibition.

The edges of the stimulus are accentuated by lateral inhibition. Mach noticed that when two bars, one dark, and one light, are next to each other, you can see little bands of extra light at the edge of the light bar and dark bands at the edge of the dark band.

To learn more about Lateral inhibition here

https://brainly.com/question/28178811

#SPJ4

in humans brown eyes are dominant over blue eyes. what type of offspring would you expect if you crossed a heterozygous brown eyed person to a heterozygous brown eyed person?

Answers

In humans, brown eyes are dominant over blue eyes. When crossing a heterozygous brown-eyed person (Bb) with another heterozygous brown-eyed person (Bb), you can expect the following types of offspring:

1. Set up a Punnett square with each parent's alleles on the outside rows and columns.

     B    b
  --------
B | BB | Bb |
  --------
b | Bb | bb |
  --------

2. Fill in the Punnett square by combining the alleles from each parent.

  BB (homozygous dominant brown eyes)
  Bb (heterozygous dominant brown eyes)
  Bb (heterozygous dominant brown eyes)
  bb (homozygous recessive blue eyes)

3. Determine the expected ratio of offspring eye colors based on the Punnett square.

- 3 out of 4 offspring will have brown eyes (BB, Bb, Bb)
- 1 out of 4 offspring will have blue eyes (bb)

So, when crossing two heterozygous brown-eyed individuals, you can expect 75% of the offspring to have brown eyes and 25% to have blue eyes.

#SPJ11

Learn more about alleles and punnett square: https://brainly.com/question/3522181

In some species of birds, mothers lay their eggs in the nests of other females. This is called brood parasitism. Sometimes, the nesting female recognizes the other bird’s egg or chick, and other times, she doesn’t. In three to five sentences, explain how parasitic behavior may affect the reproductive success of parasitic and nesting females. (4 points)

Answers

Both nesting and parasitic females may have reduced reproductive success as a result of brood parasitism. If the nesting female notices and takes away the egg or chick, the parasitic female can conserve energy but may have less success.

Which bird deposits its eggs in the nests of other birds and is a social parasite?

The cuckoo is a brood parasite, which means that it lays its eggs in the nests of other birds, who then raise the cuckoo chicks. Numerous kinds of tiny songbirds serve as foster parents the majority of the time.

When a bird lays eggs in another nest, what is the term used?

Birds notorious for laying their eggs in the nests of other birds are known as brood parasites. Cuckoos and cowbirds are two of the most well-known members of this group.

To know more about brood visit:-

https://brainly.com/question/30115329

#SPJ1

Which of the following statement is correct regarding the phylogenetic tree above? group of answer choices
- the american black bear has no closely related species. - the polar bear and the brown bear are the most recently evolved species. - the sun bear's closest relative is the sloth bear. - most bears on the phylogenetic tree are extinct.

Answers

The phylogenetic tree above represents the evolutionary relationships among various species of bears.

The American black bear is the most basal species, indicating that it has no closely related species. The polar bear and the brown bear are the most recently evolved species, with the polar bear being the most recently evolved.

The sun bear's closest relative is the sloth bear, which is a species that is still alive today. Most of the species on the phylogenetic tree are extinct, including the cave bear, the short-faced bear, and the giant short-faced bear.

This indicates that these species either went extinct due to natural selection or human caused extinction. In conclusion, the phylogenetic tree above provides us with a comprehensive view of the evolutionary relationships among the various species of bears.

Know more about phylogenetic tree here

https://brainly.com/question/30820701#

#SPJ11

if you were the lab technician trying to identify the causative organism of this foodborne outbreak, would you inoculate several biochemical tests at the same time, or would you inoculate each test after getting the results from the previous test?

Answers

As a lab technician trying to identify the causative organism of a foodborne outbreak, I would inoculаte severаl tests simultаneously, becаuse most biochemicаl tests require аt leаst 18 hours of incubаtion.

What is inoculation?

Inoculation is the act of introducing microorganisms or substances into a culture medium. This is an important step in microbiological research, as it helps to create cultures of particular microorganisms to be studied. Inoculation aids in the growth of bacteria in test tubes, plates, or flasks.

If we were the lab technician trying to identify the causative organism of this foodborne outbreak, I would inoculаte severаl tests simultаneously, becаuse most biochemicаl tests require аt leаst 18 hours of incubаtion, so inoculаting severаl tests simultаneously sаves time аnd аlso аids in conclusive identificаtion.

For more information about inoculation refers to the link: https://brainly.com/question/30480993

#SPJ11

what is the order of steps taken by b and t cells to defend against infection in body fluids and cells?

Answers

The order of steps taken by B and T cells to defend against infection in body fluids and cells are as follows:

Step 1: Recognition of the antigen by B and T cells

The first step taken by B and T cells is the recognition of the antigen, which is present on the surface of the pathogen. B cells recognize the antigens in the extracellular fluid, and T cells recognize the antigens in the intracellular fluid.

Step 2: Activation of B and T cells

After the recognition of the antigen, the B and T cells get activated. B cells differentiate into plasma cells, and T cells differentiate into effector cells. The plasma cells secrete antibodies, and the effector cells secrete cytokines.

Step 3: Destruction of the pathogen

The antibodies produced by the plasma cells bind to the antigens on the surface of the pathogen and mark them for destruction. The cytokines produced by the effector cells attract the immune cells to the site of infection, and they destroy the pathogen.

Step 4: Formation of memory cells

After the pathogen has been destroyed, the immune system forms memory B and T cells. These cells can recognize the same pathogen if it enters the body again, and they can quickly mount an immune response. This results in the prevention of the same infection in the future.

Here you can learn more about B and T cells

https://brainly.com/question/22245322#

#SPJ11  

In tomato plants, the production of red fruit color is under the control of an allele R. Yellow tomatoes are rr. The dominant phenotype for fruit shape is under the control of an allele T, which produces two lobes. Multilobed fruit, the recessive phenotype, have the phenotype tt. Two different crosses are made between parental plants of unknown genotype and phenotype. Use the progeny phenotype ratios to determine the genotypes and phenotypes of each parent. rr- yellow R- Red (a) Cross 1 progeny: 3/8 two-lobed, red 3/8 two-lobed, yellow 1/8 multilobed, red 1/8 multilobed, yellowWhat are the genotypes and phenotypes of the parents in this cross?

Answers

The genotypes and phenotypes of the parents in this cross are given as Genotype of parents: RrTt and Phenotype of parents: Red and two-lobed (RrTt).

In the given question, it is given that the production of red fruit color is under the control of an allele R. Yellow tomatoes are rr. It means that the production of the red color is dominant over the production of yellow color. The dominant phenotype for fruit shape is under the control of an allele T, which produces two lobes. Multilobed fruit, the recessive phenotype, has the phenotype tt. It means the two-lobed fruit is dominant over multilobed fruit. Two different crosses are made between parental plants of unknown genotype and phenotype.

In Cross 1, we are given the following progeny phenotype ratios:3/8 two-lobed, red3/8 two-lobed, yellow1/8 multilobed, red1/8 multilobed, yellow. Now, let’s calculate the genotype of the parent plants by the above-mentioned ratio:

There are two different fruit shapes in the ratio, 3/8 two-lobed, and 1/8 multilobed, which means that the unknown parent is Tt (as 3/8 + 1/8 = 4/8, which can be reduced to 1/2, which corresponds to heterozygous or Tt). There are two different colors in the ratio, 3/8 red, and 3/8 yellow, which means that the unknown parent is Rr (as 3/8 + 3/8 = 6/8, which can be reduced to 3/4, which corresponds to heterozygous or Rr).

Thus, the genotypes of parents are given by RrTt, and the phenotype of parents is red and two-lobed.

Read more about "Genotype"; https://brainly.com/question/25281070

#SPJ11

which of the following are true of asexual reproduction? choose all that apply. the offspring are genetically different than the parents. there is only one parent. the offspring are genetically identical to the parent. there are two parents.

Answers

Asexual reproduction is the process by which an organism reproduces by itself without requiring gamete cells from another organism. Asexual reproduction generates genetically identical offspring to the parent. Therefore, the correct answer to this question is: there is only one parent. the offspring are genetically identical to the parent.

Usually, in asexual reproduction, there is only one parent involved. This implies that there is no exchange of genetic information between two individuals. As a result, the offspring generated through asexual reproduction are genetically identical to the parent.

As a result, the genetic makeup of the parent is transferred to the offspring without alteration.In conclusion, asexual reproduction is a significant mode of reproduction among organisms that do not require the existence of the opposite sex to reproduce.

Asexual reproduction is advantageous in some ways since it does not necessitate locating a partner, and the offspring generated are often quick to mature and establish themselves in a new location.

For such more question on gamete cells:

https://brainly.com/question/7648924

#SPJ11

The following question may be like this:

Which of the following are true of asexual reproduction? choose all that apply.

the offspring are genetically different than the parents. there is only one parent. the offspring are genetically identical to the parent. there are two parents.

which of the following energy systems has the highest ranking for power production? a. anaerobic glycolysis b. lactic acid system c. atp-pc system d. oxygen system

Answers

The ATP-PC system has the highest ranking for power production. It is an anaerobic system which relies on stored ATP (adenosine triphosphate) and creatine phosphate (PC) to produce energy quickly.

This system can be used for short, high-intensity activities such as sprinting or weightlifting, and it can provide energy in just a few seconds. The energy system that has the highest ranking for power production is ATP-PC system. ATP-PC system is the energy system that has the highest ranking for power production. Adenosine triphosphate and phosphocreatine (ATP-PC) is a process that takes place in muscle cells and offers the required energy for short-term, high-intensity activities such as weightlifting, jumping, or sprinting. ATP-PC is frequently utilized for activities that take between 10 and 15 seconds. The energy produced by this system is known as immediate energy. The amount of ATP stored in muscles is quite limited, thus the body can only produce a little amount of energy before fatigue occurs.

To know more about ATP-PC system please visit :

https://brainly.com/question/12858209

#SPJ11

A ______ is a cell or cell part that detects signals from the environment.

Answers

Answer:

Sensory neuron

Explanation:

A sensory neuron is a type of nerve cell that detects and responds to external signals. Sensory neurons receive information connected to their receptors, which are part of a peripheral nervous system, and convert this information into electrical impulses.

Finches from South America were blown to the volcanic Galápagos islands off the coast and settled there.
Which statement describes what next happened to the island finches?
O They couldn't adapt to the new environment and gradually died off.
O They mutated into different forms after exposure to the volcanic environment.
O Their allele frequencies changed compared to the mainland populations.
O They continued to interbreed with other finches from South America.

Answers

The statement "Their allele frequencies changed compared to the mainland populations" describes what likely happened to the island finches after they settled on the Galápagos islands.

What is allele frequency?

Allele frequency refers to the proportion or percentage of a particular allele (variant of a gene) in a population's gene pool.

In a population with two alleles for a given gene, the allele frequency of one allele is the number of copies of that allele divided by the total number of copies of both alleles in the population.

Allele frequency is an important concept in population genetics because it reflects the genetic variation and diversity within a population, and changes in allele frequencies over time can indicate the effects of evolutionary forces such as natural selection, genetic drift, and gene flow.

Learn more about allele frequency here: https://brainly.com/question/6139888

#SPJ1

Answer:

C

Explanation:

i took the test

Explain how atheists respond when shown that the word Yahweh is embedded in human DNA.
Include 4 to 5 sentences.

Answers

Answer:

Arguments against the existence of God

Evil: Because evil exists, God cannot be all-powerful. ...

Pain: Because God allows pain, disease and natural disasters to exist, he cannot be all-powerful and also loving and good in the human sense of these words.

Injustice: ...

Multiplicity: ...

Simplicity:

Answer:

See below.

Explanation:

Atheists, like anyone else, would likely respond skeptically to such a claim, especially if it lacks credible evidence or scientific support. Atheism is simply the lack of belief in a deity or deities, and does not necessarily involve a particular stance on scientific matters. However, atheists tend to place a high value on critical thinking, skepticism, and empirical evidence, and would likely demand evidence before accepting such a claim.

which vital processes occur during diffusion? cells receive more blood. cells receive more oxygen. cells receive more nutrients. cells receive more carbon dioxide.

Answers

The vital processes that occur during diffusion include cells receiving more oxygen, cells receiving more nutrients, and cells receiving more carbon dioxide. Thus, option b. , c., and d. is correct .

The diffusion of essential substances into the cells and the elimination of waste products are critical life processes that occur during diffusion. It's the way in which molecules move across a membrane to reach equilibrium.

Cells receive more oxygen, nutrients, and carbon dioxide, while waste products are eliminated from the cells. For example, when we inhale, we breathe in oxygen, which diffuses into our bloodstream and travels to the cells, where it is used for respiration.

Meanwhile, carbon dioxide, a byproduct of respiration, diffuses out of the cells and into the bloodstream.

The bloodstream carries it back to the lungs, where we exhale it. Nutrients in our food are also absorbed through diffusion and transported to the cells where they are used for energy.

Therefore option b. , c. , and d. is correct.

To know more about Diffusion please visit:

https://brainly.com/question/7161064

#SPJ11

which vital processes occur during diffusion?

a. cells receive more blood.

b. cells receive more oxygen.

c. cells receive more nutrients.

d. cells receive more carbon dioxide.

How does the life cycle of a star compare to that of a human? In your answer, explain where in that life cycle main-sequence stars fit. Then, compare main-sequence stars with red giants in terms of relative surface temperature, size, and elemental composition.

Answers

The life cycle of a star can be compared to that of a human in terms of distinct stages of development, each characterized by different physical and chemical changes.

The life cycle of a star?

The life cycle of a star starts with the formation of a protostar from a cloud of gas and dust and this stage can be compared to the prenatal stage of a human, as it is the beginning of the development process.

With the formation of protostar , it enters the main sequence stage, which can be compared to the early years of a human's life.

After the main sequence stage, stars with less than about 8 times the mass of the sun will evolve into red giants and this stage can be compared to the middle and later years of a human's life, as the star undergoes known changes.

In terms of relative surface temperature, main-sequence stars are generally hotter than red giants.

In terms of size, red giants are much larger than main-sequence stars.

In terms of elemental composition, main-sequence stars like the sun aremade up of  of hydrogen and helium, with trace amounts of heavier elements.

Learn more about main-sequence stars  at: https://brainly.com/question/14631675

#SPJ1

FILL IN THE BLANK Complete the following paragraph explaining how reaction velocity depends on enzyme concentration.
The amount of enzyme is normally ________ the amount of substrate. Therefore, .______________If you increase the amount of enzyme, you will see ____________in the reaction velocity.

Answers

The correct answer would be: The amount of enzyme is normally less than the amount of substrate. Therefore, increasing the enzyme concentration increases the rate of the reaction.

What would happen if the amount of enzyme is increased?
If you increase the amount of enzyme, you will see an increase in the reaction velocity due to an increase in the number of successful collisions between the enzyme and substrate, leading to a surge in reactants that are capable of forming products.

What is an enzyme?

Enzymes are molecules that work as catalysts. They speed up reactions occurring in living beings. They are also known to increase the reaction rate.

How does enzyme concentration affect reaction velocity?

The velocity of a reaction is directly proportional to the concentration of the enzyme. When there is enough enzyme present, the rate of reaction will increase. The reaction velocity is directly proportional to the enzyme concentration.

To know more about enzymes and reaction velocity, visit:

https://brainly.com/question/20462984

#SPJ11

short preganglionic neurons and long post ganglionic neurons correctly describes the anatomical makeup of:

Answers

Short preganglionic neurons and long post ganglionic neurons correctly describes the anatomical makeup of the autonomic nervous system

The autonomic nervous system is made up of two branches, the sympathetic nervous system and the parasympathetic nervous system. Each branch has preganglionic and postganglionic neurons. The preganglionic neurons in the autonomic nervous system are typically shorter than the postganglionic neurons, and they connect to the postganglionic neurons at ganglia, which are clusters of neurons outside the brain and spinal cord.

The postganglionic neurons then go on to connect to their target organs, such as the heart, lungs, or digestive tract.

Learn more about sympathetic nervous system at:

https://brainly.com/question/30627266

#SPJ11

how is glycolysis related to the ability of hemoglobin to bind oxygen? in what type of cell is this reaction important? how is the allosteric effector of hemoglobin 2,3-bisphosphoglycerate (2,3-bpg) related to glycolysis?

Answers

As glycolysis interacts with deoxygenated hemoglobin beta subunits, it lowers their oxygen affinity and allosterically encourages the release of the oxygen that is still present.

In other words, by attaching to hemoglobin, 2,3-BPG lowers hemoglobin's affinity for oxygen, moving the entire oxygen-binding curve to the right. This explains how hemoglobin can efficiently transport oxygen throughout the body, releasing around 66% of it to working muscles.

2,3-Bisphosphoglycerate (2,3-BPG) is a metabolite that is primarily the allosteric effector for hemoglobin and is found in high quantities in RBCs. In the RBC, 2,3-DPG controls the allosteric characteristics of hemoglobin. Hemoglobin's affinity for oxygen is reduced and the T-state conformation is stabilized when 2,3-DPG is attached to it.

Learn more about glycolysis Visit: brainly.com/question/1966268

#SPJ4

polar bodies are cell structures that are typically found inside an ovum. true or false

Answers

Answer: yes

Explanation: the polar body is small haploid cell that is creaat t the same time egg cell during oo genesis but generally doesnot have to fertilize

based on griffith's results, what would you expect if you injected both heat-killed type rii and living type siii?

Answers

Based on Griffith's results, if you inject both heat-killed type RII and living type SIII, option B: the mouse dies.  

Frederick Griffith, an English bacteriologist, carried out his experiment in 1928. Griffith combined live, non-virulent bacteria with a heat-inactivated, virulent kind of bacteria in his experiment. He discovered a mixture of serotypes from both the living R bacteria and the heat-killed S cells that resulted in a significant R to S transformation in the mouse.

Therefore, for instance, co-injecting heat-killed SI bacteria into R cells produced from Type SII cells led to effective transformation. In Griffith’s experiment, the R to S transformation refers to the transformation of non-virulent bacteria into virulent bacteria.

To know more about Griffith's experiment, refer:

https://brainly.com/question/13147103

#SPJ4

Complete question is:

Based on Griffith's results, what would you expect if you injected both heat-killed type RII and living type SIII?

A) the mouse lives B) the mouse dies

a chromosome contains three genes in the following order: a - b - c. the distance between gene a and b is 5 mu. the distance between b and c is 3 mu. what is the expected likelihood of a double crossover? multiple choice question. 15 0.0015 0.0008 .30

Answers

The expected likelihood of a double crossover between genes a and c  is b) 0.0015.

The expected likelihood of a double crossover between genes a and c can be calculated by multiplying the individual probabilities of each crossover event. Since there are two potential crossover events between a, b, and c, we need to consider the probability of each event occurring.

Assuming that each crossover event is independent, the probability of a crossover between a and b is 0.005 (5 mu/1000 mu) and the probability of a crossover between b and c is 0.003 (3 mu/1000 mu). Therefore, the expected likelihood of a double crossover is the product of these two probabilities, which is:

0.005 x 0.003 = 0.000015 or 0.0015 (as given in the choices).

Therefore, the correct answer to this multiple-choice question is 0.0015.

For more questions like Crossover click the link below:

https://brainly.com/question/9437153

#SPJ11

What is the answers for these?

Answers

The correct types of selections include:

9. In a lake in South Africa, Directional selection10. Panthers with teeth, Stabilizing selection11. Large squirrels, Disruptive selection12. Intrasexual selection13. Natural selection (no specific type of selection)What are selections?

Selection is the process by which certain traits or characteristics become more or less common in a population over time, due to the effects of environmental or other factors on the survival and reproduction of individuals with those traits.

There are several types of selection that can occur, for example:

Sexual selection: the process by which certain traits become more or less common in a population due to their effects on mating success.Artificial selection: the process by which humans intentionally breed animals or plants for specific traits or characteristics.Directional selection: a type of natural selection in which one extreme of a trait distribution is favored, causing the average value of the trait to shift in that direction over time.

Learn more on selections here: https://brainly.com/question/12263919

#SPJ1

The questions are:

Write the correct type of selection:

9. In a lake in South Africa, guppies are eaten by the pike fish, and the larger the guppy, the more difficulty it has escaping its pike fish predator.

10. Panthers with teeth that are too short have difficulty capturing prey, while panthers with teeth that are too long have difficulty chewing their food.

11. Larger squirrels can carry larger acorns to their burrows, and they outcompete smaller squirrels when acorn supplies are limited.

12. Large cuttlefish males can outcompete other males for access to mates. Small cuttlefish can trick larger males into thinking they are females so they get a chance to get close to real females without getting attacked.

13. A species of rabbits can have white, black, or gray fur. Most predators that hunt the rabbits do so at night when it is dark.

The image below compares a normal DNA
sequence and one mutated to produce sickle
cell. Describe how the DNA strand has
been mutated and examine the amino
acid sequence. Is this a frameshift
mutation? How do you know?
Hemoglobin DNA strand
ATGGTGCACCIGACTCCTGAGGAGAAG
amino acid sequence (val his leu thr pro glu glu
Sickle cell hemoglobin DNA strand
ATGGTGCACCTGACTCCTGTGGAGAAG
amino acid sequence val his leu thr pro val glu

Answers

The image is unattached. A DNA strand can be mutated through various mechanisms, such as exposure to ultraviolet light, radiation, and certain chemicals, or spontaneous errors during DNA replication.

How is the DNA strand mutated?

These mutations can take the form of base substitutions, insertions, or deletions, and may affect a single nucleotide or a larger segment of DNA.

Amino acid sequences are determined by the sequence of nucleotides in a DNA strand. In the process of transcription, DNA is copied into RNA, and during translation, the RNA is read by ribosomes and translated into a sequence of amino acids, forming a protein. Each set of three nucleotides, called a codon, corresponds to a specific amino acid. If a mutation occurs in a DNA strand, it may alter the sequence of codons, which in turn could lead to a change in the amino acid sequence of the resulting protein.

To examine the amino acid sequence, the mutated DNA sequence must first be transcribed into RNA, and then translated into a protein. The resulting amino acid sequence can be analyzed and compared to the original, non-mutated sequence to determine the effects of the mutation.

Read more on DNA strand here:https://brainly.com/question/29037480

#SPJ1

a child with myopathy was found to have reduced oxidative phosphorylation but no mutations to the mt dna. interestingly, transcription rates were greatly reduced in mt of the child. what could explain these results?

Answers

The results could be explained by a defect in the mitochondrial transcription machinery.

This would lead to reduced transcription rates, which could then explain the reduced oxidative phosphorylation observed in the child with myopathy.

Mitochondrial transcription is essential for the production of proteins which are essential for oxidative phosphorylation, which is a fundamental metabolic process. In this case, the reduced transcription rates indicate a defect in the mitochondrial transcription machinery, likely a mutation or deficiency in one or more of the transcription factors that are responsible for the production of these proteins. This defect could lead to reduced oxidative phosphorylation in the affected individual, as is observed in this case. Thus, this explains the observed results of reduced oxidative phosphorylation but no mutations to the mtDNA.

To know more about mtDNA  click on below link:

https://brainly.com/question/28937546#

#SPJ11

what are the advantages of having an alga and a fungus in a lichen? what could each organism contribute to the partnership?

Answers

There is a symbiotic link between algae and fungi. Fungi without chlorophyll pigments eat algae. On the other hand, fungi benefit algae by protecting them and facilitating water absorption.

What benefits do an alga and a fungus having combined in a lichen?

Another such collaboration between fungi and another organism to obtain nutrients is lichens. The fungus may grow and spread because its algae companion photosynthesizes and gives it nourishment.

What connection exists between algae and the lichen fungus?

Lichens are frequently understood to be symbiotic associations between a fungus and a partner that contains chlorophyll, either green algae or cyanobacteria. A suitable habitat is provided by the fungus for its partner, which supplies the system with fixed carbon from photosynthetic processes.

To know more about chlorophyll pigments visit:-

https://brainly.com/question/21904360

#SPJ1

according to the principle of segregation, the gametes of a heterozygous individual will be .

Answers

According to the principle of segregation, the gametes of a heterozygous individual will be: a combination of either one of the alleles that the individual carries.

A heterozygous individual is an individual that has two different alleles of a gene. These alleles differ in their nucleotide sequence, thus resulting in differences in the phenotype they confer. During the formation of gametes, the alleles segregate from each other so that each gamete carries only one allele of each gene.

This means that the two alleles carried by a heterozygous individual will segregate from each other during the formation of gametes. For example, consider a heterozygous individual that carries one dominant allele and one recessive allele for a trait.

During gamete formation, the two alleles will segregate from each other, resulting in the formation of gametes that carry only one allele. This means that half of the gametes produced by the heterozygous individual will carry the dominant allele, while the other half will carry the recessive allele.

Therefore, the gametes of a heterozygous individual will be a mixture of the two different alleles that the individual carries, with an equal chance of each allele being passed on to the offspring. This principle of segregation is a fundamental principle of genetics and is essential for understanding how genetic traits are inherited from one generation to the next.

To know more about heterozygous refer here:

https://brainly.com/question/3712307#

#SPJ11

which feature is shared by both prokaryotic and eukaryotic cells? diploid chromosomes inherited from several parents complex cilia and flagella cell division employing a mitotic spindle photosystems housed in chloroplast membranes

Answers

The feature that is shared by both prokaryotic and eukaryotic cells is cell division employing a mitotic spindle. Thus, the right option is (C) cell division employing a mitotic spindle.

Prokaryotic cells lack a nucleus, so the genetic material is located in the cytoplasm, because prokaryotes do not have organelles, the genetic material is not isolated from the remainder of the cell. Eukaryotic cells are distinguished by the presence of a nucleus and other organelles enclosed within membranes. The Mitotic Spindle is a term used to describe the microtubule-based structure that separates the chromosomes into the daughter nuclei during cell division (mitosis). During cell division, both prokaryotic and eukaryotic cells utilize a mitotic spindle for chromosome segregation, which is a shared feature.

Learn more about mitotic spindle: https://brainly.com/question/30420845

#SPJ11

what sample size is needed to estimate the mean white blood cell count in cells per mircroliter for the population of adults

Answers

To estimate the mean white blood cell (WBC) count in cells per microliter for the population of adults, you need a sample size that is large enough to be representative of the population.

Generally, sample sizes of at least 30 are considered sufficient for accurate estimates. However, larger sample sizes are preferable, especially if the population is diverse or heterogeneous.

The sample size should also reflect the level of precision needed to accurately estimate the mean white blood cell count.

In other words, the sample size should be big enough that small changes in the sample size won’t have a large effect on the accuracy of the estimates.

The most reliable way to determine an appropriate sample size is through power analysis. This analysis involves calculating the amount of variability in the population, the desired precision of the estimate, and the confidence interval desired. Once these values are calculated, the sample size can be determined.

Ultimately, the sample size needed to estimate the mean white blood cell count in cells per microliter for the population of adults depends on the variability in the population, the desired precision of the estimate, and the confidence interval desired.

Power analysis is the most reliable way to determine an appropriate sample size.

To know more about white blood cell (WBC), refer here:

https://brainly.com/question/28196639#
#SPJ11

genetic evidence suggests modern humans descended from a populatin that evolved in africa. what is the nature of this evidence

Answers

Answer: The genetic evidence suggests that modern humans descended from a population that evolved in Africa. The nature of this evidence is that various genetic studies have shown that the genetic variation among humans is greatest among Africans, and the diversity decreases as one moves away from Africa.

The nature of this evidence is that various genetic studies have shown that the genetic variation among humans is greatest among Africans, and the diversity decreases as one moves away from Africa. Genetic evidence suggests modern humans descended from a population that evolved in Africa.

What is DNA?

DNA stands for deoxyribonucleic acid. It is a long, thread-like molecule made up of nucleotides, which are the building blocks of life. DNA holds the genetic information that determines the traits and characteristics of living organisms. Humans have 23 pairs of chromosomes, and each chromosome contains a unique sequence of DNA. The complete set of DNA in an organism is known as its genome.



Learn more about DNA here:

https://brainly.com/question/264225#




#SPJ11

Analysis Questions. To answer questions #1-5, use the letter "f" to indicate the recessive Falcon anemia allele
and the letter "F" for the normal allele. [5pts]
1. What is Arlene's genotype? Response

Answers

Answer:

Explanation:

You must include the phenotype of Arlene so we can determine the genotype. Without any information, I am unable to help you.

If you can provide me with Arlene's phenotype or any other information, I will be glad to help.

Just comment below!

Neural signals from olfactory cilia are transmitted to the
areas of the brain.
A. thalamus . . . olfactory cortex
B. olfactory bulb . . . olfactory cortex
C. olfactory cortex . . . olfactory bulb
D. olfactory bulb. . . thalamus
and then transmitted to the
and other

Answers

Answer:

C.      Olfactory cortex

Explanation:

Olfaction first occurs in the sensory cilia of olfactory neurons, and the generated olfactory signals are transmitted to the olfactory cortex and to other area of the brain through synaptic connections of olfactory neurons with downstream neurons, such as mitral or tufted cells, in the main olfactory bulb.

Other Questions
why does the pressure rise as the volume of a cylinder filled with a gas is decreased by a piston? multiple choice question. gas particles move faster in a smaller volume. collisions with the walls are more frequent. collisions of gas particles with each other are more frequent. PLEASE HELP AND PLEASE SHOW ALL STEPS IT WOULD BE VERY MUCH APPRECIATED!! Solve the compound inequality. Graph the two inequalities on the first two number lines and the solution set on the third number line. which of the following statements about evolution and ecology is true? evolutionary processes and ecological processes can occur on similar time scales. evolution by natural selection is generally not mediated by ecological phenomena (such as predation). please help ! QUICK no trolling the natural resources defense council, the sierra club, the national civic league, and the common cause are all examples of ? a. membership associations b. citizen groups c. professional associations d. ideological groups e. public-sector groups Jason worked for 14/3 hours on Monday, and his friends Sheldon worked for 25/6 hours.How many more hours did Jason work than Sheldon? please help me again juan owns 7 pairs of pants, 5 shirts, 6 ties, and 8 jackets. how many different outfits can he wear to school if he must wear one of each item? once all the sequencing data is collected, individual sequence reads must be mapped to the reference genome. for this question the reference sequence is shown in blue. how many single nucleotide polymorphisms (snps) are present in this sequencing data set? Which number line shows the graph of x>11 How much will a new TV be worth now if it depreciates by 9% each month, and you bought it new 8 months ago for $2740?Give your answer to two decimal places.How much it's worth after 8 months =$ One of outstanding journal recently published an article indicating differences in perception of gender equality on the job between men and women. The article claimed that women perceived the gender equality problem to be much more compared to men. One question asked of both men and women was: "Do you think gender equality is a major problem in the workplace?" 60% of the women responded "Yes", compared to men about 25%. Assuming W designates women's responses and M designates men's, what hypothesis should journal test in order to show that its claim is TRUE? one-tailed two-tailed a) a pharmacist wants to test whether the effect of a placebo is different from zero. b) holdem motors wants to test whether the mean time to assemble a car is less than 24 hours. c) ihi insurance wants to test whether the mean time to process a claim is less than 7 days the decision-making process is: a. interpersonal, interactive, and interrelated b. interpersonal, interdisciplinary, and integrated. c. integrated, interrelated, and interdisciplinary. d. interactive, integrated, and interrelated. Which equations have the same value of x as Three-fifths (30 x minus 15) = 72? Select three options. 18 x minus 15 = 72 50 x minus 25 = 72 18 x minus 9 = 72 3 (6 x minus 3) = 72 x = 4.5 believing that we can release to a higher power some things that are beyond our control relieves stress by providing a sense of tranquility and security. group of answer choices true false .a semi-elliptical arch in a stone bridge has a span of 6 meters and a central height of 2 meters. find the height of the arch at a distance of 1.5 m from the center of the arch. when 171 v is applied across a wire that is 11 m longa nd has a 0.44 mm radius, the magnitude of the current density is 1.3 x 10^4 2. Claire earns $92, 400 a year gross pay as a company president. She has 5%of her gross pay deposited into a 401(k) retirement plan. How much money does Claire's company deposit into her 401(k)retirement plan each month?$300$385$275$325