How many feet are in 120 inches?
Enter your answer in the box.
ft

Answers

Answer 1
10 feet are in 120 inches
Answer 2

The required converted value is 10 feet, which is 120 inches into feet.

As we know that unit conversion is the process of converting a quantity from one unit of measurement to another. It refers to multiplying the given quantity by a conversion factor that blends the two proportional units.

To convert inches to feet, we use the conversion factor:

1 foot (ft) = 12 inches (in)

Therefore, to convert 120 inches to feet, we divide by the conversion factor:

120 inches / 12 in/ft = 10 feet

So, there are 10 feet in 120 inches.

Learn more about the unit conversion here:

brainly.com/question/3810064

#SPJ6


Related Questions

A bicyclist at White’s 14 miles in 112 minutes. If she continues at this speed, how long will it take her to travel 35 miles?

Answers

Answer:

280 minutes.

Step-by-step explanation:

112/14=8

8*35=280

These two graphs show the same data. What is
different about the two graphs?
the vertical scale
the horizontal scale
the width of intervals
the starting values of the intervals

Answers

Answer:

A. (the vertical scale)

2nd part is the Bottom graph

Step-by-step explanation:

Answer:

A. The Vertical Scale

Step-by-step explanation:

the other one has more value than the other....And i got it right from

---------------------------------------E D G E N U I T Y 2 0 2 0--------------------------------------

hope this helps. :P

If a town with a population of 5,000 doubles in size every 60 years, what will the population be 120 years from now?​

Answers

Answer:

The population in 120 years will be 15,000.

Step-by-step explanation:

5,000 --> Now

10,000 --> In 60 years

15,000 --> In 120 years

You're welcome!

Answer:

The towns population in 120 years would be 10,000

Step-by-step explanation:

120÷60=2

5,000 x 2 = 10,000

What is the translation for this graph?

Answers

Answer:

It's the second option

Step-by-step explanation:

The x moves over to the right for a positive 3

The y moves up for a positive 4.

Hope this helps! :)

Complete the square for the following expression
and write the resulting expression as a binomial squared.
x² + 8x +_____=(_____)^2

Answers

Answer:

16, x+4^2

Step-by-step explanation:

To find the perfect square with an A factor of 1, just double the next number.

Two supplementary angles. One angle is 25 more than the second angle, find the measure of the second angle. The measure of the second angle is

Answers

Answer:

  77.5°

Step-by-step explanation:

Let s represent the measure of the second angle. Then the first angle is s+25. These two angles are supplementary, so their sum is 180:

  (s+25) +s = 180

  2s = 155

  s = 77.5

The measure of the second angle is 77.5°.

1. Diego earns $10 per hour babysitting. Assume that he has no money saved
before he starts babysitting and plans to save all of his earnings. Graph how
much money, y, he has after x hours of babysitting
Step 1:
Step 2
Step 3:

Answers

The equation is 10x=y I’m not sure how we’re supposed to show a graph over this app

The required expression for the Digo earning is y = 10x and the graph of the expression is shown.

Given that,
Diego earns $10 per hour babysitting. Assume that he has no money saved

before he starts babysitting and plans to save all of his earnings.

What are functions?

Functions are the relationship between sets of values. e g y=f(x), for every value of x there is its exists in a set of y. x is the independent variable while Y is the dependent variable.

Here,
Let the hours of babysitting be x,
According to the question,
Hourly rate is $10 for x hour the total charge is,
y = 10x

Thus, the required expression for the Digo earning is y = 10x and the graph of the expression is shown.

learn more about function here:

brainly.com/question/21145944

#SPJ2

How many liters are in 260 ounces?

Answers

Answer:

7.68912

Step-by-step explanation:

The answer is ->7.68912

-54 over 9=
can I have help

Answers

Answer:

-54 over 9= -6

Help please I’m so confused lol

Answers

Answer:

13

Step-by-step explanation:

Just substitute the x with a 4

4² - 4 + 1

16 - 4 + 1

12 + 1

2. The set of whole number from 1 to 20
Set C = all the even numbers
Set D = all the multiples of 4​

Answers

Answer:

c:2,4,6,8,10,12,14,16,18,20

Step-by-step explanation:

set d:4,8,13,15,20

which function has an inverse that is also a function?

Answers

Answer:

I think its the first one

The function that has an inverse function is{(-4,6), (-2,2), (4,2), (11,21).

What is an inverse function?

An inverse function refer to a function which alter or cause changes to other function given.

Therefore, The function that has an inverse function is{(-4,6), (-2,2), (4,2), (11,21).

Learn more about inverse function below.

https://brainly.com/question/3831584

#SPJ6

In a geometric series
If a1=6 and r=5 find s9

Answers

Answer:

I have no idea how to solve that but can you teach me how !

Harvey has 514 stamps. He places an equal number of stamps in 3 stamp books. How many stamps are in each book? Are there any stamps left over

Answers

There are 171 stamps in each book since 514 divided by 3 = 171.3 but since there cannot be 1/3 of a stamp, 1 stamp is left over.

Answer: 171 stamps, 1 left over

Solve for x: 13x + 12] = 18
O = x
X = 2, X = -10
O x = 2, x = -2
O x = 10, x = -10
X = -2, x = 10

Answers

Answer = x= 0

Step-by-step explanation:

If you had a bank that offered 6.1% interest and compounded money 4 times a year, how many years would go by until you could turn $6000 into enough to buy a brand new car ($12,000)?

Answers

Answer:

t = 11.45 years

Step-by-step explanation:

A = p(1+r/n)^nt

A = future value = $12000

P = present value = $6000

n = number of periods = 4

r = interest rate = 6.1% = 0.061

t = number of years = ?

t = log(A/P) / n[log(1 + r/n)]

= log(12000/6000) / 4[log(1+0.061/4)]

= log(2) / 4[log(1 + 0.01525)]

= 0.3010 / 4[log(1.01525)]

= 0.3010 / 4(0.00657)

= 0.3010 / 0.02628

= 11.45 years

Simplify the following expressions ?
-9x+9x^2+8x^2+4x

Answers

Answer:

-5x+17x^2

Step-by-step explanation:

Hope that helps good luck

9514 1404 393

Answer:

  17x^2 -5x

Step-by-step explanation:

"Simplify" in this context means "combine like terms." It can help to group the terms with the same variables.

  -9x+9x^2+8x^2+4x

  = 9x^2 +8x^2 -9x +4x

  = x^2(9+8) +x(-9+4)

  = 17x^2 -5x

Example 3 with Try Another One
ë Additional Example 3
)) Explain whether each of the following is a
rational number.
A. 4.078
B. 5.033919
C. 0.20878356

Answers

A 4.078 because it isn’t a repeating decimal

How far apart are parallel lines m and n such that T (ΔXYZ) = (Rn ∘ Rm)(ΔXYZ)?

Answers

Answer:

Parallel lines m and n are 6 units apart

Step-by-step explanation:

what is 13,899 rounding to the thousands

Answers

Answer: 14,000

...............................

Answer:

Step-by-step explanation:

round 13,899 to the nearest thousands which would be

14,000

A board 60 in long is cut into two parts so that the longer piece is 5 times the shorter. What are the two lengths of the two pieces ?
The shorter piece is _____ a° in
the longer piece is _____a° in​

Answers

Answer:

Longer piece: 50 in

Shorter piece: 10 in

Step-by-step explanation:

Lets make the shorter piece = x

Leta make the longer piece = 5x

Since the longer piece is 5 times the shorter, this is why we put 5x, because 5 times the shorter. We also have to find the two lengths of the pieces which in total equals 60 in.

x + 5x = 60 in

If we substitute the x to 10:

10 + 50 = 60 in

10 in = shorter length

50 in = longer length

Which fractions are equivalent to 3/5 Check all that apply.

Answers

Answer:

12/20    21/35    30/50

Step-by-step explanation:

These are all equivalent fractions to 3/5.

Hope this helps!

The fractions that are equivalent to 3/5 are C) 12/20, D) 21/35, and E) 30/50.

To determine which fractions are equivalent to 3/5, we need to find fractions that can be simplified to the same value.

The fraction 3/5 cannot be simplified further because 3 and 5 have no common factors other than 1.

Let's check each option:

A) 8/10 can be simplified to 4/5, which is not equivalent to 3/5.

B) 8/15 cannot be simplified further, but it is not equal to 3/5.

C) 12/20 can be simplified to 3/5, which is equivalent to 3/5.

D) 21/35 can be simplified to 3/5, which is equivalent to 3/5.

E) 30/50 can be simplified to 3/5, which is equivalent to 3/5.

Therefore, the fractions that are equivalent to 3/5 are C) 12/20, D) 21/35, and E) 30/50.

Learn more about the fraction here:

brainly.com/question/10354322

#SPJ6

What is the solution to the system of equations graphed below
Y=2x-7 y=-x-1

Answers

The value of the common solution to the system of equation is (2,-3).

What is System of Equation?

The system of equation is set of equations which have a common solution.

The figure shows the graph of two equations, these equations are a straight line function and the common solution is represented by a point in the image.

The solution of the system of equation can be obtained both by solving using substitution method and even by plotting the graph and finding the  intersection point.

The system of equation is,

y = 2x - 7

y = -x -1

The value of y from equation 2 will be substituted in equation 1

-x -1 = 2x -7

3x = 6

x = 2

Substituting this value in equation 2

y = -2 -1

y = -3

The value of (x,y) is (2,-3)

The graph is plotted and the intersection of the line is at (2,-3)

To know more about System of Equations

https://brainly.com/question/12895249

#SPJ5

Answer:

The answer is (2,-3)

Step-by-step explanation:

8-3 is even or odd ammmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm

Answers

Answer:

ummmm... odd

Step-by-step explanation:

Odd

Because if you try to multiply it would be it nothing would be equal to 8

What is 6 1/2 doubled?

Answers

Answer:

13

Step-by-step explanation:

6 1/2 x 6 1/2

or

6.5 + 6.5 =13

6+6=12

0.5 + 0.5=1

12+1=13

the double of 6 1/2 is 26/2, which simplifies to 13

To find the double of 6 1/2, we first convert the mixed number 6 1/2 to an improper fraction. We multiply the whole number (6) by the denominator (2), which gives us 12. Then, we add the numerator (1) to get 13. So, 6 1/2 as an improper fraction is 13/2.

To double this fraction, we multiply the numerator (13) by 2, resulting in 26. The denominator remains the same (2). Therefore, the double of 6 1/2 is 26/2, which simplifies to 13. In other words, doubling 6 1/2 gives us the whole number 13.

Learn more about fraction here

https://brainly.com/question/11096884

#SPJ2

Respuesta de la expresión 5 + {4 * 6÷3+1+ [3-(4-8) + (3-2)] }

Answers

Answer:

Vota Trump

Step-by-step explanation:

PLEASE HELP WILL GIVE BRAINLIEST PLSSSSS

Answers

Answer:

c

Step-by-step explanation:

AM = 5x - 2 and MB = 2x + 19, Find the length of AB

Answers

Answer:

The answer would be: -0.01

Step-by-step explanation:

1) State what is given

AM = 5x -2 and MB = 2x +19

2) Make an equation that can satisfy the problem

AM + BM = AB

This is the equation, because if I am to put this on a line,

A                        M                         B

-_____________-_____________-

You can see that is you combine the lengths AM and BM you can find the total length of  AB.

A                        M         +           M                        B    

-_____________-          +           -_____________-

(M point is actually one point, but I am trying to show that if the line were to be cut in half, then put back together you get you full length, which is AB)

3) Substitute

(5x - 2) + (2x + 19) = AB

4) Now Solve!

5x - 2 + 2x + 19 = AB

(Rearrange to combine like terms)

5x + 2x + 19 - 2 = AB

7x + 17 = AB

(That is your equation to find AB! But they want the specific length)

So...

We solve it!

7x = -17

(By moving the 17 to the other side of the = sign, it becomes negative)

7x = -17

7       7

(Dividing both sides by 7 in order to get x alone)

x = -2.43

(I rounded to the hundredths place)

Now substitute that into x into you original equation)

5(-2.43) - 2 + 2(-2.43) + 19 = AB

-12.15 - 2 - 4.86 + 19 = AB

-14.15 - 4.86 + 19

-19.01 + 19 = -0.01

= -0.01

(I believe this would be the answer, but it doesn't seem to fit right, so please understand, that if this is wrong, I AM SO SORRY ;-;)

(I tried my best on this problem, but I bet it isn't the answer, so if I get this wrong tell me so that I can remove it! :)

Determine whether this picture is an example of a function, relation, function and relation, or neither relation nor function

A:function only
B:Relation only
C:Neither function nor relation
D:Function and relation

Answers

Answer:

C:Neither funtion nor relation

C:Ni función ni relación

espero que te sirva marcarme como mejor respuesta PORFA y gracias

Answer:

relation only

Step-by-step explanation:

A relation is a set of one or more ordered pairs.

A function is a relation in which each element of the domain is paired with EXACTLY one element of the range.

The Vertical-Line Test: Given the graph of a relation, if a vertical line can be drawn that does not cross the graph in more than one place, it is a function.

Any vertical line drawn where x > -4 will cross the graph in more than one place.

Therefore, the graph is not a function, it is a relation only.

Jonathan forgot his math homework on the kitchen table and left for school without it. He biked at the speed of 15 mph. His mother saw the homework when he was already 1 mile from home, and started chasing him. She drove at a speed of 25 mph and caught him at the school entrance. How far is the school from Jonathan's home?

Answers

Answer:

2.5 miles

Step-by-step explanation:

We know that: time = distance/speed

Now, if the distance of the school from Jonathan's home is y.

At speed of 15 mph, Jonathans time is; time = y/15 hours

At 25 mph, his mother's time was;

time = y/25 hours

We are told that Jonathan was 1 mile from home when he saw his mother.

Thus means that difference in time is;

Time difference = 1/15 hours

Thus;

y/15 hours - y/25 hours = 1/15 hours

Multiply through by 75 to get;

5y - 3y = 5

2y = 5

y = 5/2

y = 2.5 miles

Other Questions
What is mass? In matter and energy A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power