PO
Question 1
Maria took a taxicab from her home to the theater
downtown. The taxicab company charges a flat fee of $5.00
plus $0.25 per mile. Which equation represents C, the total
cost of her ride, in terms of m, the length of the trip in
miles?

Answers

Answer 1

Answer:

C=5+0.25m

Step-by-step explanation:


Related Questions

I need help please thanks!

Answers

Answer:

f=39

Step-by-step explanation:

hi! first, we can multiply by 12 on both sides to eliminate the 12 in the denominator.

f+3= (7/2)*12

f+3=84/2

f+3=42

now, subtract 3 on both sides.

f=39

9.1 divided by 5 using standard algorithm

Answers

Answer:

1.82

Step-by-step explanation:

What is the reason for each step in the solution of the equation?
-6x+7x+14=3

Answers

Answer:

See Below

Step-by-step explanation:

Step 1:

- 6x + 7x + 14 = 3       Given

Step 2:

x + 14 = 3     Combine like terms

Answer:

x = - 11       Subtraction Property of Equality

Hope This Helps :)

4x-3=2x+7
Help me pleasee

Answers

Answer:

x = 5

Step-by-step explanation:

4x-3=2x+7

Subtract 2x from each side

4x-2x-3=2x-2x+7

2x-3 = 7

Add 3 to each side

2x-3+3 = 7+3

2x = 10

Divide by 2

2x/2 = 10/2

x = 5

add 3 to the other side
4x=2x+10
minus 2x
2x=10
divide by 2
x=5

Solve: 2n - 3(4+5) = -6(n-3) - 1

Answers

Answer:

n=11/2 or 5 1/2

Step-by-step explanation:

Answer:

Step-by-step explanation:

Distribute:

2n-12-15=-6n+18-1

Combine like terms:

2n-27=-6n+17

Put -27 on other side and -6n on other side:

8n=44

Divide:

n=5.5

which expression forms an equation with the given expression? 8•7-4=

Answers

Answer:

the answer to this equation is 52

Step-by-step explanation:

need help question is on question

Answers

Answer:

y = 7x + 2

Step-by-step explanation:

Here's attachment on what the table looks like and the slope intercept equation.

High Hopes ^^

Barry-

Answer:

y = 7x + 2

Step-by-step explanation:

makes sense i double check the others person.

1. what is the x of "5x - 4 = 3x + 8"
2. what is the x of "-4x + 7 = -7x - 8"
3. what is the x of "6x + 7 = -4x - 4

Answers

Answer:

1. x= -2  2. x= -5  3. x= -11/10

Step-by-step explanation:

1. 5x-3x -4+4=3x-3x+8+4   2x/2=-4/2  x=-2

2. -4x+7x +7-7=-7x+7x-8-7  3x/3=-15/3  x=-5

3. 6x+4x+7-7=-4x+4x-4-7   10x/10=-11/10   x=-11/10

HELP GIVING BRAINLIEST!

Answers

Answer:

A. 430

Step-by-step explanation:

Range is the difference between the highest and lowest values. In this case it is 790 and 360. Subtract the highest and lowest and you get 430

When two balanced dice are rolled, there are 36 possible outcomes. Find the probability that the sum is a multiple of 3 or greater than 6.

Answers

The answer is 9 it’s a multiple of 3 and is also greater than 6

Answer:

  7/9

Step-by-step explanation:

All but 8 of the 36 outcomes are a multiple of 3 or greater than 6. The probability is ...

  p(x mod 3 = 0 | x > 6) = 28/36 = 7/9

John made $122 in 8 hours.how much did he make per hour

Answers

Answer:

$15.25

Step-by-step explanation:

It’s 15.25 I believe

John has 1 1/4 acres of land. it takes 80 1/2 pounds of fertilizer to cover one acre. How much fertilizer does John need to cover his land.

Answers

[tex]area \: of \: land \: with \: john \: = 1 \frac{1}{4} \: acres \ \\ \\ = \frac{(4 \times 1) + 5}{4} \\ \\ \\= \frac{9}{4} \: acres[/tex]

Quantity of fertilizer needed to cover 1 acre of land :-

[tex] \: \ \\ = 80 \frac{1}{2} \: pounds \\ \\ = \frac{(2 \times 80) + 1}{2} \\ \\ = \frac{81}{2} \: pounds[/tex]

Quantity of fertilizer needed by John to cover his land :-

[tex] \frac{9}{4} \times \frac{81}{2} [/tex]

[tex] \frac{(9 \times 2 ) \times (81 \times 4)}{8} [/tex]

[tex] \frac{(18 \times 324)}{8} [/tex]

[tex] = \frac{5832}{8} [/tex]

[tex] = 729 \: pounds[/tex]

∴ John needs 729 pounds of fertilizer to cover his land .

a) sin2000x + cos2000x =
1
21999

Answers

Answer:  The number of solutions to the equation sin (2000x) = 3/7 in the interval [0,2π] is (A) ... 1 answer A sinusoid with amplitude 4 has a minimum value of 5.

1 answer

Step-by-step explanation: : You always have sin2(x)+cos2(x)=1. Now how do sin2(x)+cos2(x) and sin2000(x)+cos2000(x) relate if (sin(x),cos(x))≠(±1,0) and (sin(x),cos(x))≠(0,±1)?

The graph is posted now.

Answers

Answer:

where is the graph itself?

Answer:

  see below

Step-by-step explanation:

Pre-image: A(3, 8), B(3, 3), C(7, 3)

Reflection in the x-axis changes the y-coordinate sign:

  A'(3, -8), B'(3, -3), C'(7, -3)

Reflection in the y-axis changes the x-coordinate sign:

  A''(-3, -8), B''(-3, -3), C''(-7, -3)

__

Comment

We have assumed that the first image is reflected again to get the second image. If the second image is supposed to be a reflection of the pre-image, then only the sign of x will change from the pre-image coordinates.

There are no "rotated" images; only reflected ones. (Though, after the second reflection, the image could be considered to be a 180° rotation of the pre-image.)

helppp

britney has already run 10 miles on her own, and she expects to run 3 miles during each track practice. how many track practices would it take for britney to run 40 miles

Answers

Answer:

It would take her 10 track practices to get up to 40 miles.

Step-by-step explanation:

PLEAEE HELP!!!

Which term describes the distance from the center of a circle to any point on
the circle?
O A. Circumference
B. Diameter
O C. Center
D. Radius

Answers

Answer:

D. Radius

The Radius is half the diameter. The center of the cirlce is like the half way point in the circle. The diameter goes from one end of the cirlcle to another passing through the center. If the line goes from the center to any point on the circle that is the radius.

The term describes the distance from the center of a circle to any point on

the circle is the radius.

Option D is the correct answer.

What is a circle?

A circle is a two-dimensional figure with a radius and circumference of 2pir.

The area of a circle is πr².

We have,

The distance from the center of a circle to any point on

the circle is the radius.

Now,

Diameter is the distance that passes the center from any two points on the circumference.

Thus,

The term describes the distance from the center of a circle to any point on

the circle is the radius.

Learn more about circle here:

https://brainly.com/question/11833983

#SPJ7

Simplify using the associative property.
(-4) • (-7.2) • (-5)

Answers

Answer: -144

Step-by-step explanation:

all you have to do is multiply -4 times -7.2 times -5.

The dots between the numbers are multiplication signs.

What is the solution of the following system
8x + 14y = 4
-6x - 7y = -10

a) (4,-4)
b (4,-2)
c (2,5)
d (6,-4)

Answers

Step-by-step explanation:

8x + 14y = 4 ...1

-6x - 7y = -10 ...2

...2 × 2 in 2 sides of the equation

-12x -14y = -20 ...3

...1 + ...3

8x + 14y +(-12x -14y) = 4 +(-20)

8x + 14y - 12x -14y = 4 - 20

-4x = -16

x = (-16)/(-4)

= 4

replace x in ...1 or ...2 you will reserve y value

and answer in the term of (x,y)

HELP URGENT!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

The equation has an Inifinite amount of solutions

Step-by-step explanation:

2 ( 3g + 2 ) = 1/2 ( 12g + 8 )

First use the distributive property of multiplication -

6g + 4 = 6g + 4

6g cancels out from both sides of the equation -

4 = 4

When both sides of an equation are the same there is an infinite amount of solutions.

Hope this helped! :)

(7x^8-10v)-(4x^8+2v)

Answers

3 ( x^8-4v) ........... .

Use point-slope form, y - y1 = m(x - x1), to find the linear equation of a line that passes through the points
(2, -1) and (10, 7).

y =
x+

Answers

Answer:

y = ✔ 1x+ ✔ -3

Step-by-step explanation:

The equation of the line passing through the points (2, -1) and (10, 7) is y =  x - 3.

What is the point slope form of the equation of a line?

The point slope form of a line is given by -

y - y₁ = m(x - x₁)

Given is a line that passes through the points (2, -1) and (10, 7).

The point - slope form of a line is given by the general equation -

y - y₁ = m(x - x₁)

We will find the slope of the line as follows -

m = (7 + 1)/(10 - 2) = 8/8 = 1

The line passes through the point (2, -1), so we can write the equation of line as -

y - (- 1) = x - 2

y + 1 = x - 2

x - y = 3

y =  x - 3

Therefore, the equation of the line passing through the points (2, -1) and (10, 7) is y =  x - 3.

To solve more questions on straight line, visit the link below-

https://brainly.com/question/10730695

#SPJ5

30 points Solve for y 4y+11=17

Answers

Answer:

1.5

Step-by-step explanation:

4y + 11 = 17

     -11     -11

      4y = 6

     /4     /4

       1y = 1.5

Please help me solve these question the best answer gets brainlest!

Answers

Answer:

Q.13 66.66, Q.14 0.141 cm

Step-by-step explanation:

T = L(8 + RS)
Solve for R

Answers

Answer:

Step-by-step explanation:

T=L(8+RS)

T=L8+LRS

T-L8=LRS

R=T-L8/LS

The required solution to the given equation is R = (T - 8L)/LS.

What is the equation?

The equation is defined as a mathematical statement that has a minimum of two terms containing variables or numbers that are equal.

The equation is given in the question, as follows:

T = L(8 + RS)

Apply the distributive property of multiplication,

T = L × 8 + L × RS

T = 8L + LRS

Rearrange the terms in the above equation,

T - 8L = LRS

Divided by LS into both sides, and we get

R = (T - 8L)/LS

Thus, the required solution to the given equation is R = (T - 8L)/LS.

Learn more about the equations here:

brainly.com/question/10413253

#SPJ2

2x + 14 + x =(3x + 6)​

Answers

Answer:

0=8, no soluction

<3

Red

Answer:

0=-8

Step-by-step explanation:

3x+14=3x+6

3x+14-14=3x+6-14

3x=3x-8

3x-3x=3x-8-3x

0=-8

Solve for x. Just enter a number for your answer.
2 po
7
(8x - 77)
m
(3x + 38)
Your answer

Answers

Answer:

87

Step-by-step explanation:

try langs need kasi para maka

hmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm

87

Using suitable identity evaluate 105 × 95​

Answers

Answer:

105 × 95​

(100+5)  × (100-5)

(100)² - (5)²

10000 -25

9975

Step-by-step explanation:

105*95 is equal to 9975

if the radius of a ball is 8 cm then calculate its area​

Answers

Answer: 804.25 cm sq.

Step-by-step explanation:

A = 4 π r^2

A = 4 π 8^2

A = 4 π 64

A = 804.25 cm sq.

Which of the following is theGiven the equation 2square root of x minus 5 = 2, solve for x and identify if it is an extraneous solution. radical expression of a to the five sevenths power?

Answers

√x - 5 = 2
√x = 7
x = ±√7 or ±2.645751

Ella wants to buy forks and spoons for her new house. Forks cost 1$ each and spoons cost 4$ each. She spent 50$ and bought 20 items in total. Which equations represent this word problem?

Answers

Answer:

50 = 1(x) + 4(y)

Step-by-step explanation:

I'm not too sure about this answer, its more of a guess but I hope this helped :)!

X = amount of forks bought

y = amount of spoons bought

Other Questions
You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful