Triangle J K L. Side J K is 5 inches and side J L is 10 inches.
Which could be the length of Side K L?
4 in.
9 in.
16 in.
19 in.

Answers

Answer 1

Answer:

9 in.

Step-by-step explanation:

the sum of two sides in a triangle is always longer than the 3rd side. so 9 is the only answer that fits this condition.


Related Questions

PLEASE HELP ME ASAP!!!!!!!

In a party, the guest's attendance depends on their vehicle status. If they have four wheelers then the attendance of guests is 2500 and if they have two wheelers then the attendance of guests is 1500. If on the next party, 70% of families will have four wheelers and 30% of families will have two wheelers. What is the expected attendance of guests?

Answers

When 70% of families will have four-wheelers and 30% of families will have two-wheelers, the projected guest attendance is 3000+1200 = 4200.

what is percentage ?

In mathematics, a percentage is a number or ratio that is expressed as a fraction of 100. Occasionally, the acronyms "pct.," "pct," and "pc" are also used. But it is commonly indicated by the percent sign, "%." The % amount has no dimensions. Percentages are essentially fractions when the denominator is 100. Use the percent sign (%) to indicate that a number is a percentage by placing it next to it. For instance, you score a 75% if you properly answer 75 out of 100 questions on a test (75/100). Divide the money by the total and multiply the result by 100 to calculate percentages. The formula for calculating the percentage is (value/total) x 100%.

given

2500 guests are present when four-wheelers are available.

two wheelers, the number of guests is 1500,

making the total 2500 + 1500 = 4000.

70 percent of families will own four-wheelers, or 3000/4000/100.

30% of families will own two-wheelers, which equals 4000/100 * 30%, or 1200.

When 70% of families will have four-wheelers and 30% of families will have two-wheelers, the projected guest attendance is 3000+1200 = 4200.

To know more about percentage visit:

https://brainly.com/question/29306119

#SPJ1

PLS PLS HELP ASAP!!! ILL GIVE BRAINIEST AND 50 POINTS!!!

Identify or mark the missing side or angle that would make triangle ABC congruent to triangle PDF by AAS

Answers

Answer:

F and C

Step-by-step explanation:

CUZ AAS means angle angle side

Answer:

see explanation

Step-by-step explanation:

for the triangles to be congruent by the angle- side- angle (ASA postulate )

if two angles and the included side of one triangle are congruent to two angles and the included side of another triangle ( included side is the side between the vertices of the two angles ) , then the triangles are congruent.

given

∠ B ≡ ∠ D and AB ≡ PD

then the included sides are AB and PD

the other 2 angles for congruency are ∠ A ≡ ∠ P

-----------------------------------------------------

By the AAS postulate

If two angles and a non included side of one triangle are congruent to the corresponding parts of the other triangle, then the triangles are congruent

for AAS then ∠ C ≡ ∠ F

Samantha correctly solved the equation x2 -4x= 4 by completing the square. Which equation is part of her solution?

Answers

Answer:

±

2

2

+

2

Step-by-step explanation:

Which graph matches the system of equations

2x+3y=5
4x−5y=−1


Responses

Answers

The graph of equation is in image.

What are linear equations?

When a linear equation is graphed, it always results in a straight line because each term has an exponent of 1. This is why it is referred to as a "linear equation."

There are linear equations with one and two variables, respectively.

Given equations

2x + 3y = 5

4x - 5y = -1

For equation 1

2x + 3y = 5

The table of values appears as follows

x    1     -2    4

y    1      3    -1

Coordinates for equation 2

4x - 5y = -1

The table of values as thus

x    1     2    -4

y    1     1.8   -3

And the intersection point of equation is (1, 1)

Hence the graph of equation is intersecting at (1, 1).

Learn more about graph of linear equations on https://brainly.com/question/28494690

#SPJ1

In conditional probability, the notation P(
AB) is read:
"The probability of event A occurring given that event B has
occurred."
For example: In the following two-way table
P(Walk to school Sophomore) = 37 (2 + 25 + 3) = 0.1
Grade Drive to school Take the bus
Walk
Sophomore
2
25
3
Junior
13
20
2
Senior
25
5
5
P(Take the bus Sophomore ) = [?]

Answers

Answer:

0.83

Step-by-step explanation:

It’s right use the formula they give you

The probability of a student taking the bus given that the student is sophomore is 0.83

Given that:

P(Walk to school | Sophomore) = 3 /(2 + 25 + 3) = 0.1

To cal culate the probability of a student taking the bus given that the student is sophomore, we make use of:

P(Take the bus | Sophomore ) = 25/(2 + 25 + 3)

Rewrite properly as:

[tex]Pr= \frac{25}{2 + 25 + 3}[/tex]

So, we have:

[tex]Pr= \frac{25}{30}[/tex]

Divide 25 by 30

[tex]Pr= 0.83[/tex]

Hence, the probability of a student taking the bus given that the student is sophomore is 0.83

Read more about probabilities at:

https://brainly.com/question/251701

Find an equation for the line that passes through the points (-5, 2) and (3, 4)

Answers

Answer: y = 1/4x + 3.25

Step-by-step explanation:
1. Find the slope first using y2 - y1/ x2 - x1. This should look like 4 -2/ 3 - (-5), which can also be written as 4 - 2/ 3 + 5.

2. Simplify the fraction. This should look like 2/8, which can also be written as 1/4 once you divide it by 2.

3. Use the point-slope formula to find the y-intercept of the equation now. The formula is y2 - y1 = m (x2 - x1). Input either (-5, 2) or (3,4) into the equation. I'll use (3,4) as an example. After inputting that point, the equation would be y - 4 = 1/4 (x - 3).

4. Simplify this equation by distributing the 1/4 into the parentheses first. Once done, the equation will be y - 4 = 1/4x - 0.75.

5. Add 4 on both sides of the equation to get y by itself. After that the equation will be y = 1/4x + 3.25.

In a middle-school mentoring program, a number of the sixth graders are paired with a ninth-grade student as a buddy. No ninth grader is assigned more than one sixth-grade buddy. If 13 of all the ninth graders are paired with 25 of all the sixth graders, what fraction of the total number of sixth and ninth graders have a buddy

Answers

Answer:

13/25

I hope this is the correct answer.

if u answer correct u r a math god its hard trust me

Answers

Answer:

27 square units

Step-by-step explanation:

Area of triangle = 1/2(b)(h)

Base = 6

Height = 9

1/2(6)(9)

1/2(54)

Area = 27 units

In an animal shelter, the ratio of cats to dogs is 6 to 9. How many CATS were in the shelter 1 point
if there were 36 dogs at the shelter? please help !!

Answers

Answer:

24 cats

Step-by-step explanation:

The ratio of cats to dogs is 6:9. There are 36 dogs in the shelter. Let's make the number of cats x.

6:9=x:36

You multiply 4 with 9 to get 36, so you do the same for 6.

6 x 4 = 24

24 cats in the shelter

HELP PLEASE How many combinations are possible to select a student president, vice president, and treasurer among 23 students? Assume a student cannot hold more than one office.

Answers

Answer:

10,626

Step-by-step explanation:

Because being the student president is different from being the treasurer, the order in which students are selected for these roles matters. Therefore, a permutation is used to calculate the number of combinations that are possible, with nPr = n/(n-r) or evaluate it by doing 23c3.

A stone was thrown into a pond from 8 feet above the surface of the water in the pond. Justin wrote 8 feet to represent the height from which the stone was thrown. What does 0 represent in this situation

Answers

0 represents the height of the water itself

what is an equation of the line that passes through point (-6,-5) and is parallel to the line x + 5y=25

Answers

Answer:

y = -1/5x - 31/5

Step-by-step explanation:

If two lines are parallel to each other, they have the same slope.

The first line is x + 5y = 25.

First, let's put this in standard form of y = mx + b.

x + 5y = 25

Subtract x from both sides.

5y = -x + 25

Divide each term by 5.

y = -1/5x + 5

This line's slope is -1/5. A line parallel to this one will also have a slope of -1/5.

Plug this value (-1/5) into your standard point-slope equation of y = mx + b.

y = -1/5x + b

To find b, we want to plug in a value that we know is on this line: in this case, it is (-6, -5). Plug in the x and y values into the x and y of the standard equation.

-5 = -1/5(-6) + b

To find b, multiply the slope and the input of x (-6)

-5 = 6/5 + b

Now, subtract 6/5 from both sides to isolate b.

-5 - 6/5 = b

-25/5 - 6/5 = b

-31/5 = b

Plug this into your standard equation.

y = -1/5x - 31/5

This equation is parallel to your given equation (y = -1/5x + 5) and contains point (-6, -5)

Hope this helps!

What are the two types of measurements of angles?

Answers

The two types of units that are used for the angle measurements are (d) degrees and radians .

The two types of Units of Measurements are Radians and Degrees ,

The unit Degrees is used to measure the direction and angle size. If the object is facing north, then the object is said to be at 0°. If the object turn the opposite direction to face south, then the object turned 180°.

A full circle comprises of 360 degree .

The Radian is an S.I. unit of measuring the angles , one radian is defined as angle made at center of a circle by an arc whose length is equal to radius of circle.

The value of 1 radian is approximately equal to 57.296 degree .

The given question is incomplete , the complete question is

What are two types of angle measurements ?

(a) metrics and radians

(b) radians and metrics

(c) degrees and metrics

(d) degrees and radians

Learn more about Angle Measurement here

https://brainly.com/question/16848385

#SPJ4

Determine how many solutions exist for this system of equations:
y = -3x+6
y=-3x – 5

A= No solution
B= One solution
C= infinity many
D= Two solutions

I’ve been having a few mistakes with substitution so pls help

Answers

Answer:

No Solution

Step-by-step explanation:

-3x+6=-3x-5

+5 +5

-3x+11=-3x

+3 +3

11=0

No Solution

What is the opposite reciprocal of 0/6

Answers

Answer: The reciprocal of a number is defined as 1 divided by that number. The opposite of a number is the number with the opposite sign. Therefore, the opposite reciprocal of a number is equal to the reciprocal of the opposite of that number.

In this case, the opposite reciprocal of 0/6 is the reciprocal of the opposite of 0/6. The opposite of 0/6 is 0/-6, which is equal to -0/6. The reciprocal of -0/6 is 1/(-0/6) = -6/0.

However, division by 0 is not defined, so it is not possible to find the reciprocal of -0/6. Therefore, the opposite reciprocal of 0/6 is undefined.

Step-by-step explanation:

Answer:

there is no reciprocal for 0/6

Step-by-step explanation:

The table provides information on road accidents reported to the police for the days in December.


Accidents reported l Frequency

3 - 7 l 17

8 - 12 l 1

13 - 18 l 1

19 - 25 l 12


Estimate the range.

Answers

The range of the accidents reported from the grouped frequency table is 22.

What is a range in a set of data?

The range is the difference between the highest value and the lowest value of a given set of data.

We have,

The number of accidents reported from the grouped frequency table.

The largest number of accidents = (19 - 25)

The smallest number of accident = (3 - 7)

Now,

Range.

= 25 - 3

= 22

Thus,

The range of the reported accidents is 22.

Learn more about range here:

https://brainly.com/question/15953457

#SPJ1

Simplify (4s^5t^-7/-2s^-2t^4). Write your answer using only positive exponents. Evaluate any numerical powers.
I'LL NAME YOU BRAINLIEST

please help!! ​

Answers

In positive exponents, the simplified form of the above polynomial is s⁷/t¹¹.

What is polynomial?

A polynomial is a mathematical statement made up of indeterminates and coefficients that solely includes the operations of addition, subtraction, multiplication, and positive-integer powers of variables. x2 4x + 7 is an example of a polynomial with a single indeterminate x. A polynomial is an expression in mathematics that consists of variables (also known as indeterminates) and coefficients and includes only the operations of addition, subtraction, multiplication, and non-negative integer exponentiation of variables.

Here,

=4s⁵*t⁻⁷/-2s⁻²*-2t⁴

=s⁷/t¹¹

The simplified form of given polynomial is s⁷/t¹¹ in positive exponents.

To know more about polynomial,

https://brainly.com/question/11536910

#SPJ4

Find the value of w, then x. Round lengths of segments to the nearest tenth pls help

Answers

Answer:

option b is the correct answer

A helicopter pad which is in the shape of a circle has a circumference of 62. 48 feet and a diameter of 24 feet. Which expression best represents the value of ?

Answers

The expression which represents the value of the area could be the six times the circumference of the circle.

What is area of circle ?

area of circle can be defined as the product of pi(3.14) and square of radius of the circle.

Given,

helicopter pad which is in the shape of a circle has a circumference 72.48

and the diameter of 24 feet.

radius = diameter/2

radius = 24/2

radius = 12

circumference of circle = 72.48

area of circle =  π*r*r

area of circle = 22/7 * 12 * 12

area of circle = 452.5

area of circle is approximately 6 times the circumference of circle.

Hence , The expression which represents the value of the area could be the six times the circumference of the circle.

To learn more about Area of circle from the given link.

https://brainly.com/question/28642423

#SPJ4

Multiply.
(x - 2)(x + 3)

Answers

I’m pretty sure the answer is x^2 + x - 6

Answer:

espero y te ayude esto de aquí

HELP ME WITH THIS> WILL MARK BRAINLIEST

Answers

Answer:

I think x = 8

Step-by-step explanation:

Help me please
in this worksheet

Answers

Answer:

the document doesnt open up for me

Step-by-step explanation:

Which pair of functions have the same domain?
A. f(x)= cos x and g(x)= tan x
B. g(x)= tan x and f(x)= sec x
C. f(x)= sin x and f(x)= sec x
D. g(x)= tan x and f(x)= cot x

Answers

Answer is B. g(90)=tan90=undefined and f(90)=sec(90)=undefined

which number is equivalent to (-14+6)-8÷4×4​

Answers

Answer:

-16

Step-by-step explanation:

(-14+6)-8/4x4

-14+6=-8

-8-8/4x4

Following order of operations, we divide first, then multiply, then add/subtract.

-8-(8/4)x4

-8-2x4

-8-(2x4)

-8-8

-16

---

hope it helps

Answer: its -16

Step-by-step explanation:

can someone help me do my homework

Answers

Answer:

(0, -8)

Step-by-step explanation:

Because the question asks for the y-axis intercept, the x coordinate will automatically be 0. Then we just look at where parabola intersects the y axis (-8), and that's the y coordinate. Finally, we put those two numbers together:

(0, -8)

Answer:

(0, -8)

Step-by-step explanation:

That is where the y-intercept happens.

Hope this helps! Please leave any questions or concerns in the comments. byeee <3

what is the approximate volume?

Answers

Answer:

A. 524m^3

Step-by-step explanation:

Formula for volume of sphere:

[tex]V = \frac{4}{3} \pi r^3[/tex]

If we use 3.14 for pi, we get:

V = 4/3(3.14)(5)^3

V = 523.33

answer : 524m :))

good bye

This probability distribution shows the
typical grade distribution for a Geometry
course with 35 students.
Grade
A
BCDF
Frequency
5
10
15
3
2
Find the probability that a student earns a
grade of A, B, or C.
p=[?]
Enter a decimal rounded to the nearest hundredth.

Answers

Answer:

85.71% probability

Step-by-step explanation:

30 of 35 of the students are in abc range so take 35/100% or 0.35 and go 30/0.35 and you get 85.71%

The average mass of a giraffe is approximately 1x 10^8 kilograms. The average mass of a blue whale is approximately 2x 10^6 kilograms. About how many times more mass does a giraffe have than a blue whale?

Answers

Answer:

Giraffe = 1,000 kg

Whale = 2,000,000 kg

Step-by-step explanation:

Whale has 2,000 times the mass.

Can I please get Branliest and rate, like Thank you!

How do you solve this

Answers

The measure of angle TQW from the given figure is 25°.

What are perpendicular lines?

A perpendicular is a straight line that makes an angle of 90° with another line. 90° is also called a right angle and is marked by a little square between two perpendicular lines as shown in the figure. Here, the two lines intersect at a right angle, and hence, are said to be perpendicular to each other.

Given that, QT⊥PQR at Q, QW⊥QS at Q, and m∠SQP=25°.

From the given figure, m∠SQP+m∠SQT=90° -------(I)

m∠TQW+m∠SQT=90° -------(II)

Here, equation (I)=(II), we get

m∠SQP+m∠SQT=m∠TQW+m∠SQT

m∠SQP=m∠TQW

25°=m∠TQW

Therefore, the measure of angle TQW from the given figure is 25°.

To learn more about the perpendicular lines visit:

https://brainly.com/question/18271653.

#SPJ1

A cylinder has a diameter of 8 inches and a volume of 128 cubic inches.What is the height of the cylinder?

Answers

16,

You divide 128 ÷ 8
Other Questions
How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board