What’s wrong with this sentence I like dogs, he likes cats

Answers

Answer 1

Answer:

I like dogs, and he likes cats.

or

I like dogs and he likes cats.

Explanation:


Related Questions

would you say being assigned your job or career by government is volation of individual right

Answers

Yes, being assigned a job or career by the government is a violation of individual rights.

What is government?
Government
is a system of governing an area, people, or organization, usually consisting of a body of elected or appointed officials. Government is responsible for setting and enforcing laws, collecting taxes, providing services, and making decisions that benefit the community. Governments also provide public goods, such as education, infrastructure, healthcare, and public safety. Governments can be divided into three types: democratic, autocratic, and hybrid. Democratic governments are based on the principle of majority rule, while autocratic governments are ruled by one individual or small group.

Everyone has the right to choose their own career and job, and having the government make those decisions for them is a clear violation of those rights.

To learn more about government
https://brainly.com/question/1078669

#SPJ1

Imagine your future son is thinking about illegal migration. He is planning to go to Libya and then into Europe by boat. Give him some advice.​

Answers

Answer:

If your son is considering illegal migration, he should be aware of the risks involved. There is a very real danger of drowning at sea, or of being intercepted and returned to Libya. Once in Libya, migrants face exploitation, detention, and violence. Many migrant women are raped. There is also a risk of being sold into slavery.

1.
Enrichment
The children in the third grade class did a science experiment. Write
six sentences, telling what the children did. Use a different verb in
the past time in each sentence. The words in the picture may help
you.
TURN
EVERY
DAY
1. Plant the seeds.
2. Follow directions.
3. Watch the plant.
4. Talk about the

Answers

Contrary to popular belief, some people believe the PTE English written test to be simpler than the IELTS test.

What does the scientific term enrichment mean?

Enrichment culture is essentially an isolation method created to create very favorable growing circumstances for a target organism while creating an environmental catastrophe for any potential competitors. published in 2019's Recent Innovations in Applied Microbial and Biochemistry

What three sorts of enrichment are there?

It may be broken down into four subcategories: olfactory (smell and taste), auditory (sound), tactile (touch), and visual enrichment. All of these senses play a crucial role in communication and serve as avenues for acquiring environmental data.

To know more about Enrichment visit:

https://brainly.com/question/14840026

#SPJ1

What is the difference between Imagery and metaphor?
Imagery is typically a sentence or two, while metaphors are short phrases.
Imagery does not compare one thing to another the way a metaphor does.
They are both types of comparisons, but they differ in the type of things they compare.
There is not any difference; they are interchangeable terms for the same concept.

Answers

Answer:

Imagery does not compare one thing to another the way a metaphor does.

he should definetly wite down all the necessary informationto___ forget it

Answers

Answer: He should definitely write down all the necessary information to not forget it.

Explanation:

Your boss, Jane Smith, has suggested changing the time off policy to allow employees to use their 15 days in anyway they want.
write an email to Jane expressing your opinion about the time off policy

Answers

The answer includes an email expressing thoughts about a suggested change in time off policy, allowing employees to use their 15 days in any way they want. The letter appreciates the flexibility but also raises concern about potential issues, such as possible abuse of the policy and manpower problems during busy periods.

Dear Jane,

Thank you for sharing your new thoughts on the time off policy. I believe that flexibility in the usage of the 15 days off can indeed bring positive effects. It would accommodate the employees' various needs and therefore could potentially increase overall job satisfaction.

However, some important factors need to be considered. For instance, it would be crucial to put in place some measures to prevent possible abuse of such a policy. We should also make sure that there would always be enough manpower in our busy periods, even when several employees might decide to take days off simultaneously.

I hope you find my insights helpful in your decision making. I look forward to hearing more about your final decision on this matter.

Best regards,

Learn more about flexible time off policy here:

https://brainly.com/question/27960475

#SPJ2

Why has the writer of the letters in Frankenstein decided to make this journey?
A. This has been a dream that he has had since he was young.
B. He is being paid a large sum of money to do it.
C. Here is a good job waiting for him once he gets there.
D. A friend dared him to do it.

Answers

Since he was a child, he has dreamed of the letters in Frankenstein setting out on this adventure.

In Frankenstein, why does Walton write the letters?

Since arriving at Archangel in March, Robert Walton has been alone. He diligently prepares a ship and crew, but he longs to pass the time with someone who is similar to himself. He finds some solace in his sister's letters, but he longs for friendship.

The purpose of Shelley's letters in Frankenstein

In order to give the book greater depth, Shelley used the letters. We might think of the parallels between characters as distinct voices telling the same story from various angles. Depending on the viewpoints of the individual characters, each perspective affects how the story is told.

To know more about Frankenstein  visit:-

https://brainly.com/question/11431072

#SPJ1

Levi wrote several sentences for his rhetorical analysis of the Elizabeth Cady Stanton's "Declaration of Sentiments." How can Levi arrange the sentences in a paragraph to clearly show relationships among claims, counterclaims, reasons, and evidence?

Her use of these well-known words
masterfully combines the logos of
the original document's
"self-evident" with the ethos of
referencing such a foundational
document.

However, this rhetorical strategy
allows her to compound the effects
of several rhetorical devices in a
relatively brief text.

Some might say that Elizabeth Cady
Stanton's use of allusion to the
Declaration of Independence is
melodramatic.

For example, she uses the clause
"We hold these truths to be
self-evident," echoing the
Declaration of Independence.

Answers

Repetition, allusion, and pathos were among the literary devices employed by Elizabeth Cady Stanton to support her arguments for the expansion of women's rights.

What is the Declaration of Sentiments' rhetorical context ?

The rhetorical appeal that was used most frequently in "The Declaration of Sentiments" was pathos. The paragraph served to convey the grievances held by women across the country.

Pathos is most obvious since the author uses the emotions felt by women all around the world to make their point.

Repetition, allusion, and pathos were among the literary devices employed by Elizabeth Cady Stanton to support her arguments for the expansion of women's rights.

Thus, Repetition, allusion, and pathos were among the literary devices employed by Elizabeth.

For more information about Declaration of Sentiments' rhetorical context, click here:

https://brainly.com/question/29790411

#SPJ1

Answer:

1: Some might say that Elizabeth Cady

2: However, this rhetorical strategy

3: For example, she uses the clause

4: her use of these well-known words

Explanation:

just took the test

What is an ampere? please help asap

Answers

Answer:here is yo answer

the SI base unit of electrical current.

Imagine a column of air, one inch by one inch, stretching from the ground all
the way to the top of the thermosphere. This column weighs 16 pounds (275
gallons of air)! If the average person has 125 of these columns pressing down on
their head and shoulders, how much weight are they experiencing? Show your
work.

Answers

Answer:

379

Explanation:

"...packet of energy-rich starch..." (paragraph 4)
20.
What is the effect of the figurative language "tasty prize” in paragraph 4?
A.
to explain which animals consume seeds
B.
to illustrate the food chain's competition
C.
to emphasize the seed's nutritional value
D.
to contrast the inedible parts of the tree
4

Answers

Answer C would be correct

100 pts
What argument about the role of Northern civilians is President Abraham Lincoln making in this excerpt from the Gettysburg Address?

A. He suggests that only participation of civilians through enlistment in the army can ensure victory.

B. He suggests that civilians should contribute to the war effort through monetary means.

C. He suggests that civilians can properly honor the dead only by building memorials to them.

D. He suggests that civilians can honor the dead only by honoring and helping their families.

E. He suggests that civilians can honor the dead only by honoring and supporting the ideals that they died for.​

Answers

Answer:

E. He suggests that civilians can honor the dead only by honoring and supporting the ideals that they died for.​

Explanation:

It's the plato answer!

Answer:

should be E, i just did the test and got it right

Explanation:

What does Mercutio accuse Romeo of doing in Act II, Scene IV of Romeo and Juliet?
A. Abandoning them at the feast
B. Being too scared to attempt to woo Juliet
C. Disgracing his family by talking to a Capulet
D. Cheating on Rosaline

Answers

Answer: Cheating on Rosaline


Explanation:

This makes sense because Mercutio says, “ That’s as much as to say, such a case as yours constrains a man to bow in the hams” This is referring to Romeo banging another woman that is not Rosaline.

opposite word 1. borrow 2. cruel 3. cheap 4.special 5 friendship 6. hope 7. refuse 8. bitter ​

Answers

Answer:

1. lend2. compassionate3. pricey, expensive4. trifling, ordinary5. hostility6. despair7. allow8. sweet

Hope that helps! :)

-Aphrodite

Explanation:

Complete the chart. What does ''light'' mean in this passage?
First to get correct get's brainiest it's Iready

Answers

The answer to this is a small amount

It's a small amount

How can we fight injustice? What is a modern example of
injustice and effective ways that lead to a solution?

Answers

Answer:

Eliminate global hunger and poverty.

Promote gender equality.

Fight for employment rights.

Support diversity in the workplace.

Volunteer your time.

Common examples of social injustice include the topics about discrimination, ageism and gender and sexuality. These are just the most common ones.

Explanation:

please mark this answer as brainliest

Help me out please!!

Answers

Answer:get of brainly u sumof a bach

fvbargaregrtegareg

Which of these lines from Shakespeare's Sonnet 29 portrays the emotion of joy?
A. "... And trouble deaf heaven with my bootless cries..."
B. "... With what I most enjoy contented least..."
C. "... Desiring this man's art, and that man's scope..."
D. "... For thy sweet love remembered such wealth brings..."

Answers

In the last six lines of the sonnet, the speaker no longer feels alone because he has remembered the woman of his life, and thinking about her love brings him happiness (joy); contrasting with the opening of the poem when the speaker wanders around his misfortunes; but in the end he finds his joy. Thereby the answer is (D) "For thy sweet love remembered such wealth brings".

What does Sonnet 29 say about love?Shakespeare's "Sonnet 29" is about the power of love to positively affect one's mindset, as the poem contends that love offers compensation for the wounds and setbacks one endures in life, in contrast to some of Shakespeare's other love poems, which are concerned with physical beauty and erotic desire. William Shakespeare's poem "When, in disgrace with fortune and men's eyes" is a part of the "Fair Youth" collection. These poems are an expression of the speaker's love and admiration for a young man. Sonnet 1 through sonnet 129 are included in the series. They make up the majority of the 154 sonnets that Shakespeare produced during his lifetime.

To learn more about William Shakespeare's refer to:

https://brainly.com/question/7592021

#SPJ1

ILL GIVE BRAINLY Read the sentence.

There was a severe lack of excitement in the room when we heard that the found dog wasn't our "Blazer" after all.

What is the definition of the word lack?

absence

outpour

amount

abundance

Answers

Answer:

absence

Explanation:

Answer:

absence

Explanation:

what is important while looking for a treasure

Answers

When looking for a treasure, it is important to have a detailed plan, research the area, and have the right tools and equipment. It is also important to be aware of any potential hazards and to have a backup plan in case something goes wrong.

COMPLETE ANSWER
THE ANSWER TO THE QUESTION IS I'M GOING TO VOTE BRAINLIEST

Directions: Deliver an original persuasive speech on any of the following topics. Write it when Reading is two-minute limit. Apply all the principles in presenting an effective speech.

1. My contributions for my country
2. The value of making a difference in the community
3. Teens and the Social Media
4. Topic of your interest​​​

Answers

Here is a persuasive speech on the topic of "Teens and the Social Media":

Hello everyone,

I want to talk to you today about an issue that affects all of us, especially teenagers: the role of social media in our lives.

As you all know, social media has become an integral part of our daily routine. We use it to stay connected with our friends and family, to get our news and entertainment, and to share our thoughts and experiences.

But as much as social media can be a positive force, it can also be a negative one. We've all heard the stories of cyberbullying, online harassment, and the negative impact of social media on mental health.

So, what can we do about it?

First, we need to be mindful of our own use of social media. Are we using it in a way that is positive and healthy? Are we being respectful and responsible online?

Second, we need to be there for each other. If you see a friend being bullied or harassed online, don't be a bystander. Speak up and support them.

And finally, we need to be open to change. Social media is constantly evolving, and we need to adapt and find ways to use it in a way that benefits us, rather than harming us.

So let's make a commitment to being responsible and respectful on social media. Together, we can create a more positive and healthy online environment for ourselves and for future generations.

Thank you.

I MET a traveller from an antique land Who said: Two vast and trunkless legs of stone Stand in the desert ... Near them, on the sand, Half sunk, a shattered visage [face] lies, whose frown, And wrinkled lip, and sneer of cold command, Tell that its sculptor well those passions read Which still survive, stamped on these lifeless things, The hand that mocked them, and the heart that fed; And on the pedestal these words appear: "My name is Ozymandias, king of kings: Look on my works, ye Mighty, and despair!" Nothing beside remains. Round the decay Of that colossal wreck, boundless and bare The lone and level sands stretch far away. Select one piece of evidence that supports the situational irony of the poem. (10 points) From an antique land Cold command Boundless and bare Those passions read

Answers

Answer:

When he says how he was the best and he was the "king of kings" But now nothing remains except ruins. Like it doesn't matter how great you were in life, it's not going to last forever, and your not going to take any of the glory to the grave.

Explanation:

Ch. 15
How did Tris's mom know so much about the Dauntless compound, the ranking, and
chocolate cake?

Answers

Answer:

Tris's mother knew so much about the Dauntless compound because she herself was born Dauntless to a Dauntless father.

Explanation:

The debut novel of Veronica Roth, Divergent features a dystopian Chicago and the life of its protagonist Beatric Tris Prior.

Natalie Prior, at the end of the in chapter 15, asks Tris to bring a piece of cake for her, saying the chocolate is delicious. Natalie Prior is the mother of Tris Prior in the novel. The reason that Tris's mother know so much about the Dauntless compound, the ranking, and chocolate because she herself was born Dauntless to a Dauntless father.

Natalie is herself a  divergent like her daughter, Tris. She chose the Abnegation faction on the advice of her mother.

Identify the problem in the following sentence:
Anna wants, instead of her usual espresso, a chai tea.
A. Ambiguous modifier
B. Dangling participle
c
C. Awkward modifier
D. Split infinitive

Answers

The problem in the given sentence is an awkward modifier. An awkward modifier is a word or phrase that is placed in a sentence in such a way that it creates confusion about which word it is modifying. The correct answer is C.

In this sentence, the modifier "instead of her usual espresso" is awkwardly placed in the sentence, causing confusion about what Anna wants. It is not clear whether Anna wants the chai tea instead of her usual espresso or whether she wants the chai tea in addition to her usual espresso.

To avoid awkward modifiers, it is important to place modifiers as close as possible to the word or phrase they are modifying, and to ensure that the meaning of the sentence is clear.

The correct answer is C.

To know more about awkward modifier., click here.

https://brainly.com/question/16239845

#SPJ1

1. Which best defines the word colonize as used in the FIRST paragraph?
a) To destroy or ruin a foreign land
b) To trade or do business with other people
c) To inhabit and rule a foreign land
d) To do battle or fight with another group of people
I need the answer asap

Answers

Answer:

C) I think-

Explanation:

When Greg was in the bathroom with a spider, he decided to?

The diary of a wimpy kid the getaway

Answers

Answer:

The spider first appeared in the bathroom of the Heffley family's room at the Isla de Corales resort. Greg went to put his slippers on in the bathroom after taking a shower, to find something inside of one of them. When he shook it to get the thing out, a giant spider fell out.

Explanation:

In the book Drivers Ed by Caroline Cooney whom does the music teacher choose as the most normal student?

Answers

We can see that the person that the music teacher choose as the most normal student is Lark.

What is Drivers Ed?

Drivers Ed is actually known to be a book that was written by Caroline Cooney. In the story, Remy Marland, a 15-year-old, has an ideal life. She gets lots of driving practice in her driver's education class, and Morgan Campbell, the lad she has a crush on, is starting to reciprocate her feelings.

It seems like harmless fun when Remy and Morgan choose to participate in a driver's education class practical joke that involves stealing traffic signs. When harmless fun turns into vandalism and things escalate out of control to a terrible climax, the risks of caving in to peer pressure quickly become clear.

Caroline B. Cooney keeps tackling the three main issues that teenagers struggle with the most: responsibility, conformity, and popularity.

Learn more about Drivers Ed on https://brainly.com/question/30180602

#SPJ1

write your argument for or against the topic, life in the city is more dangerous than in village

Answers

Answer:

the city is dangerous for the livelihood of the people living there . in villages the nature will clearly visible and we can enjoy the nature freely. ... in cities the population wil be more and many people cant live in builds so,they live in slum areas it very dangerous for the health of the people .

Explanation:

3) What is the meaning of “disillusioning” (line 14) in the context of passage I?
(A) unreal
(B) disgusting
(C) disabling
(D) unexpected
(E) eye-opening

Answers

Answer:

A

Explanation:

dis·il·lu·sion

cause (someone) to realize that a belief or an idea is false.

unreal = false

What does this quote mean to you?
"The world is full of kind people if you can't find one be one."​

Answers

Answer:

To me it means that even if the world is full of people that aren't kind or you can't find them then be the person people look up to, be the person that everyone can call on. (that's what it means to me)

Other Questions
In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition European exploration was motivated by a desire for economic profit. What natural resource did Europeans seek out in West Africa, South America, and a North America? How did they attempt to acquire this resource in each location? Math homework please help look at picture!! briefly describe the goals and scope of social work. she is drinking water change into negative Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA