when do humans use anaerobic respiration

Answers

Answer 1

Answer:

Anaerobic respiration in humans occurs in muscles during strenuous exercise when sufficient oxygen is not available.

Explanation:


Related Questions

The heart is within the

Answers

Answer:

the pericardial cavity

What is the main structural component of plants?

Answers

Answer: Carbohydrates are the most abundant structural component present in plants and microorganisms.

Explanation:

Answer:

Cellulose

Explanation:

Cellulose is the main structural component of plants.

Which of the following best describes the composition of a nucleotide?

Select one:

a.
a pair of six-carbon rings attached to each other

b.
a carbon atom joined to a hydrogen and three functional groups

c.
a chain of carbon atoms with a carboxyl group bonded to one end

d.
a five-carbon sugar attached to a phosphate group and a nitrogenous base

Answers

Answer:

d

Explanation:

Nucleotide is composed of 3 main subunits, which are nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates.

D

A nucleotide is composed of sugar, 5 rings, with a phosphate and a nucleotide.

A hair consists of two parts: a follicle and a shaft

Answers

Answer:

ur answer is in the screenshot below.

Explanation:

statement does not describe cell cycle checkpoints?

Answers

Answer:

Defective checkpoints results in death of the cell.

Normal checkpoints make sure the cell has enough resources for cell division. Normal checkpoints ensure the cells commits apoptosis if the cell has a problem it cannot fix itself.

What subatomic particles are found on the inside of an atom (the nucleus) and what subatomic particles are found on the outside (in the rings)?

Answers

Answer:

In the nucleus of an atom, we find 2 subatomic particles, protons, and neutrons.

On the outside, on the rings, are electrons.

I hope this helps you somewhat! :D  

TheQuestionIsWhy

A hormone signals through a G protein-coupled receptor as shown in the diagram. After the production of IP3, which of these events will MOST quickly stop the transduction of the signal?
A. the hydrolysis of IP3
B. the hydrolysis of GTP
C. the hydrolysis of PIP2
D. the hydrolysis of the hormone

Answers

Answer: The answer is A

Explanation: Took the test lol

The quickest halt to the signal transduction process after IP3 production occurs through the hydrolysis of IP3 itself, as option A.

The hydrolysis of IP3 results in the quickest termination of the signal transduction pathway among the available alternatives. A series of actions are triggered by IP3, which causes the release of calcium ions from intracellular reserves. IP3 is hydrolyzed by phosphatases, which halts the calcium release and prevents protracted signaling.

Even while the hydrolysis of GTP and PIP2 is a necessary step in the cessation of G protein-coupled receptor signaling, it happens later and does not have the same rapid effects as IP3 hydrolysis. The hormone's own breakdown is not a known mechanism for halting signal transmission.

To know more about signal transduction here https://brainly.com/question/30449991

#SPJ3

What has happened around Jakarta in recent years?



A.Large numbers of city residents have moved away to rural areas.



B.Buddhism has become the dominant religion.



C.Population growth has created a megalopolis.



D.Volcano eruptions have destroyed large sections of the city.

Answers

Answer:

letter b. Buddhism has become the dominant religion Ang sagot diyan

Answer: C Population growth has created a megalopolis.

Explanation: took the test

Which of the following would cause a plant to grow taller?

Answers

Answer:

Make plants grow taller by ensuring that their basic needs are being met. This includes water, sunlight, warmth and nutrients. Research the needs of your particular plant and provide these elements in the necessary amounts for optimum growth.

Place the smallest level of organization at the top and the largest at the bottom.
HELP PLEASE!!!!!!!!!!!!!!!!!!
Artery
Circulatory System
Smooth Muscle Tissue
Smooth Muscle Cell

Answers

Answer:

Artery

Circulatory System

Smooth Muscle Tissue

Smooth Muscle cell

Explanation:

If the chromosome number of a typical onion root tip cell is 16 before mitosis, what is the chromosome number of each newly formed nucleus after nuclear division has taken place?

Answers

Answer:

16 in each nucleus

Explanation:

Mitosis is the process of cell replication that creates two identical daughter cells. Alternativly, meoisis produces two haploid cells (each having "half" the chromosomes) from each diploid cell.

Answer:

I don't know i need help too

Explanation:

so yea

Which of the following choices is a component in the community of a wetlands
ecosystem?

A. Water
B. Sunlight
C. Soil
D. Frog

Answers

Answer: Water

Explanation:

A community is the occupied space by a population of two or more species. Water is a community component of a wetland ecosystem. Thus, option A is correct.

What is a wetland ecosystem?

Wetland is a type of ecosystem that comprises water reservoirs and has an excess of stored water in the form of bogs, marshes, and swamps. A wetland ecosystem includes many biotic and abiotic factors that interact and live together.

The wetland ecosystem is characterized by the presence of water throughout all the years. It is a valuable ecosystem that absorbs excess precipitation so as to avoid flooding and soil erosions. Hydrology, soils, and biology are the main components of the ecosystem.

Therefore, option A. water is the component of the wetland ecosystem.

Learn more about wetland ecosystem here:

https://brainly.com/question/10276047

#SPJ5

PLSSSSS ANSWER LOTS OF POINTS AND BRAINLYEST

What statement is true of a prokaryotic cell?

It is unicellular, HAS a nucleus, and has most organelles.


It is multicellular, does NOT have nucleus, and has most organelles.


It is multicellular, HAS a nucleus, and is missing most organelles.


It is unicellular, does NOT have a nucleus, and is missing most organelles.

Answers

Answer:

the first answer I believe but I could be wrong

Answer: It is unicellular, does not have a nucleus, and is missing most organelles.

Explanation:

The difference between a food web and biogeochemical cycle is -
O Food webs only pertain to ecosystems
O Geochemical cycles lose more energy
Geochemical cycles don't lose anything, food webs lose energy
O Food webs lose energy and geochemical cycles lose nutrients

Answers

Answer:

Food webs only pertain to ecosystems.

Explanation:

Activity
1. You have been presented with four outcrops from different locations.
2. Correlate matching layers of rock from the locations A, B and C so that matching
layers are next to each other. Draw lines to identify the correlated layers.
3. Draw a red line between layers of rock to identify where rock layers are missing.
4. Determine the relative age (as a range of time) of the rock layers. Label the age.
5. Try to correlate the rock layers of location D. You will answer questions specific to
layer D after completing this activity.

Answers

Answer:It's a + t _ d-e Np

Explanation:

What is the mass number of potassuum atom that has 20 neutrons

Answers

The mass number of a potassium atom is 39.

what type of materials are expelled from cells during exocytosis

Answers

Answer:

During exocytosis cells expel a variety of materials including waste products, toxins and large molecules such as hormones, proteins and neurotransmitters into the extracellular environment.

Explanation:

Waste Products, Toxins, and large molecules like hormones, proteins and neurotransmitters

Animals such as foxes and cats often prey on rabbits. Based on the growth curve of the rabbit population, what
might have happened if a group of predators moved into the rabbits habitat during the tenth generation and
began eating the rabbits?

Answers

Answer:

If this happened that would affect to amount of food the other predators got, eventually causing decreases in their species.

Explanation:

If a group of predators moved into the rabbit's habitat during the tenth generation and began eating the rabbits, it would definitely affect the amount of food and other resources that are available for other predators that directly or indirectly depend on the rabbit's population.

What is a Habitat?

A habitat may be defined as a type of natural environment for which a particular species is best adapted due to natural selection. In this natural environment, the basic demands of an organism are fulfilled like food, space, mating partner, etc.

When a group of predators starts eating the rabbits, the population of rabbits gradually decreases. Due to this, the other predators of the same species feel the scarcity of food and resources. As a result of this, their number or population also declines slowly or adapted to other species.

Therefore, it would definitely affect the amount of food and other resources that are available for other predators that directly or indirectly depend on the rabbit population.

To learn more about Predators, refer to the link;

https://brainly.com/question/10790484

#SPJ2

The photos below show three types of muscle tissue. Which type of muscle is
found only in the heart?

A. C
B. A and C
C. A
D. B

Answers

Answer:

C the heart operates on cardiac muscle

Explanation:

Crowdsourcing was used to solve problems for what science discipline?

Answers

Answer:

A. Science relies on observation, measurement, and experimentation.

Explanation:

ok Np bye!

*80 POINTS PLEASE HELP
The unit discusses and defines hydrostatic pressure. Explain what hydrostatic pressure is and how this term relates to Néry’s talk.
Explain what the term “blood shift” means and how it works.
Describe what happens when Néry falls below 80 meters in depth. How must Néry react in order to survive, and even enjoy, falling to such depths?
Néry describes many aspects of the entire experience of free diving that he finds appealing. What aspect of the free-diving experience that Néry describes appeals to you most? Why?

Answers

Answer:

Answer: Raymond Wang: How germs travel on planes – and how we can stop them

1. After completing the unit and watching the video, explain how the unit about oceans and the video about germs on a plane relate?

In his video Raymond explains how the diseases are transmitted through planes from one country to another and the difficulties faced to prevent the spread of diseases due to the air circulation in the planes. It is always difficult to screen the person with disease and prevent them from getting into the plane since the air circulates in the conventional cabins. When a person sneezes, the air will get swirled multiple times and spread the disease.

2. Using examples from the video, explain why it is difficult to keep people who are sick off of planes.

It’s difficult to pre-screen for diseases. When someone goes on a plane, they could be sick and actually be in this latency period in which they could have the disease but not exhibit any symptoms and could possibly spread the disease to many other people.

3. How does Wang illustrate what happens in a conventional airplane cabin when someone sneezes?

He illustrates how the air is just being circulated throughout the plane. When someone sneezes, the air is just being circulated into the air. This means that everyone on that plane has breathed in that person’s sneeze because it’s such a compact place.

Answer:

4.

Explanation:

Describe Wang’s solution for easily preventing the spread of disease on airplanes? What does “flow,” a word seen in the unit, have to do with his solution? The thing he made to prevent people from getting sneezes in their face is by making the bacteria flow straight towards the filters, so no one gets the bacteria in their faces.

Giving brainliest!!!!!!!!! This is the last question on the test so i bumped up the points ;)

Answers

Answer:

D

Explanation:

All living organisms have to have cells

A pyramid of biomass shows the mass of all the organisms in each trophic level of an ecosystem. Look at the biomass pyramid to the right. Based on the data shown, how many kilograms of plant matter would be needed to support the other trophic levels in this ecosystem?

Answers

Answer:

90,000

Explanation:

It would be 90,000 because it is a pattern, 90, 900, 9,000, and 90,000.

Plz help I need help

Answers

the answer isbacterial cell

Like 90% sure its bacteria cell.

How is loss of biodiversity connected to extinction of organisms?

Answers

Answer:

In an ecosystem, everything is connected. All ecosystems have some form of food chain and symbiosis. This means that animals rely on each other for life. If one animal were to die then others would be negatively affected. Overall, this means that when biodiversity is lost it becomes harder for organisms to survive. For example, pandas rely on bamboo to survive. So, when it gets cut down and destroyed the pandas also suffer. Additionally, in ecosystems, a wide variety of organisms helps other living creates have more forms of survival. This shows how important biodiversity is.

Identify organelles in a plant cell.

Answers

As I am not to familiar cell plant to the looks precise the leaf shape on option A. Please dear correct me if I’m incorrect!

When can exponential growth occur in a population? Please help

Answers

A. when food and space are unlimited

all of the others would cause a decline

please mark brainliest :)

please help me out with this newsela question

Answers

Answer: the answer is a

Explanation:because it is stating that you have to see if there is anything involving chemical substances.

Which statement best explains why the atmosphere is considered an open system?
A.
There is no definite boundary separating it from outer space.
B.
Energy and matter can enter and leave.
C.
Its molecules can move freely, without resistance.
D.
It can accept an unlimited amount of energy.

Answers

Answer:

thw anser is A

Explanation:

What is the connection between the liquid state of water and hydrogen bonding?

Answers

Answer:

In the liquid state, the hydrogen bonds of water can break and reform as the molecules flow from one place to another. When water is cooled, the molecules begin to slow down. Eventually, when water is frozen to ice, the hydrogen bonds become permanent and form a very specific network.

Explanation:

Other Questions
List 4 significant problems with nuclear power plants. im crying please help me so much 7Anna and Paddy take part in the same fun run.Anna completed the fun run in 2 hours.Her average speed was 6 kilometres per hour.Paddy completed the fun run in 90 minutes.(a) Work out Paddy's average speed in kilometres per hour. PRODUCTOR11. (Circle one) Oxygen is areleased?)REACTANTof respiration? (In other words, is it needed or Determine if 0.875 is rational or irrational and give a reason for your answer. PLEASE HELP :DDDDDDDDDD Find the volume of the rectangular prisim 6cm 4cm 12cm If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC?